Description :
From Genome Similarity Track
Location :
Scaffold_14:9162- 10183
Sequence
1021 bases(100 bases per row)
CGTCGAGGATGGCCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTGAGGCAATAGTTCCTCATCGAAGTCGAGTCTTGCTTCATT
AGTCGCGTCTAGTACCAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACGGCCTTGAGTCTCGACACATGCACTACTGGGTAAAAGCGATACCCACTT
CGGTCAGGCAGTTGCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCACCGGTGAGCTAATTTCTTCGTCAAGCCCGGTT
TGACGCGCTCCATGTACAACCACGCCCGACTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGG
GTCCGCCGAGTGTTCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGACCTCATTATGCTTTTTAGTCCTTCGCTCCTTTTCTACA
GCCTGATAATCTTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGTCACGCTAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGA
GTGATGACGACATTGCCCGCAACGTCGACTGCGCATCCCAGCCATGAACGAGGTAGAACGGTGTTTCCTTCCTTGTAGTGTCCTGAGAAGTATTAATAGC
AAACACCAGCTTCTCTGCGATTTCATCCCAATCTTGCTGTAAAGGGTCTTCCGCGTACACCCGTACGGAGCCCATCACTGACTTCACCGAGCGTTCCTGC
TGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGCCCGTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAACGTGGGTCGC
GGTCATGCCTTATTAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGC
AATAACGAATCCCGTGAACGA