Description :
From Genome Similarity Track
Location :
Scaffold_10:91606- 93069
Transcript NameFunction/comments
Phymu_g797hypothetical protein PHYSODRAFT_475220

Sequence
1463 bases(100 bases per row)
TACCCGTGTGACGCTCTCGACTTCGAGTAAGAGAGAAAATATGCAGACTGGCAACGTTTGGGGAAGTGCGTTGAGGGTGCTAACCTCATTGATAATTGTT
TCGACCTTGACGCAAAGGCATGTGCGGTTCAAACTCGCAGACACCATACTGTACCTATTGATAACGAACGCTGGTCTGTCAGACTGCTCCAGAGATCCAG
CTCTTGCAGTCTGCAATGCACGGAAAGTTTCCGTCGGAAACGAAGAGTACACAGCAGTACTATAACGCAAATCCAAAGGTGCGTACAGCGTACGATTAAC
ACTCAGTGTCTCGCGGCTGGGGCGACCCATTCTTGCCAACAAGCAGCATCATCATCTGCATGAACTGTTCGTGTCTGCGGCGGTTTTCCGCGCGCTCTTC
CGCGCGTTCTTCATTGCGATGACGCCGCTCTTCCCGCTCCTCATCCCGGCGacgttcctcctcctgtcTCCGCTGCTCGACCTCTTCTCTGCGACGTTGC
CGCTCCTCGTCCCGACGTTGTCTCTCCTCCTCTCTGTCGAGATCGCGCTGGTACTGCGACCGCAAAACAACCTTGAGCACGGACGTTAACAGATCATCTG
TCGGCAGCGGCGTGGCCTCCGGCGGGAACACGGCCGCTGGGTTCTGCCAATCTGTCGTTGGAACTGAGGCTCGCGCACGCGGACGCGTAACGGCAGCAGG
AGGCGTTGCCATAGGAGCCGGAAGGGGTACAgtcgacggagacgccgtAGCTGTAGTGGTAGCAGCACCAGGCGGCACCTCGGCCGCCGAATCCACCCAG
CTGTGCTCCGATTCAGCTCCGTCCTGTACCCGGTCGTCTGACGGTGGTGGCTGGAATGAAGCTTCACTCGAGTCCACAGGTGTCGCGCTCTCGACGCCCG
GGATTACAGCACCTGGGGCAGGCGGCACGCCTTCGACCATCTCTTTGTGCACGACGTGCGCGAATGTAATGGCTTGGTGGTTCTTGGCGCCACGCGGAGG
GATGTTCGCGCGATACAGACGCGaaaacttcttcttgagcgagTCGGCCGAGCGGTTGTGCTTGGCAAACTGCGCGTTGTGTAGCTGCGCGACGACATCC
CATCCGTCGCGCCAGCGCGCGCGCACCAGCTGCAGTAGGCCCATGGACTCGGCCTCCGTGAAGCCGTCGCCGCGGCGCTGCACATGGGGCCCTAGTCGCC
GCTtcacctccgtctccagGACGTCCTGTGGGGAAAAGCGTGCAGCCATTTTTTGGGCGGGGGAAGAATTTGAGAGTGAATGGGTGGATCAAAAATTTTG
CCTAGACAATGTGCAATCTTTATCGAACGTTTCATTAGTGGAAAGTAAACTGGGACCAATATACCAAAAATTGTATGCGAAAGTTTTTTTTAGGCGCGAA
AATGGACGGCACAGATTCGACCCAGATTTGAATTTTCGACCTTGAAGTTGACTTGGCGCCAAC