Description :
From Genome Similarity Track
Location :
contig_11:915976- 917110
Transcript NameFunction/comments
g3236.t1hypothetical protein
g3237.t1hypothetical protein

Sequence
1134 bases(100 bases per row)
GTACCAACGTCGCTAGCGCAGTTGATTCCGCACGCGAGTCCAGAAGCACTCCAGCTCATGACAGACTTGCTCAAATACGATCCAAACCAGCGACCGACAT
CAAGTCAGGCACTGCAGTACCCATTTTTCCAGGTGAACGTGAACGTGACCGTGCCGTTGACTGTATCAACACCGGGTGGGAGCAGCCAACAGCAGCAGTG
TGAACGTGTGGAGTCGACTGAAAAGTTGGCCGCTTTCACTCCGCCGCAAAAATCATCAGGAAGTCAACGGGGCGGGAGCGGACAGTATGGACGGAACCAG
CAACCGGTGGTGGACGTCGGAGGATACAGCAGCTTACGGCAACATGCTACAATCACGTCAGCTTCGTCGTATGGCATGCCACGGGTTCCCCTGCGGAATG
CTATAGCAGCAGCAGGAAGCAGCGTGCTATCCGGTGGGACACCGACTGGTATGGACAGCGGAAACATGGGCGACGCACAGGGCAGTCGCTACACGCGTCA
GGCAAGATACGCGCCAGGAATGATGTACCGAGGCGAAGGTGACGGAGCGACGTACTCGGGCGGTAGACCACCGTACGTACCGCCGGGTGTCAGTGGTGGA
CTTCCGTTGGCAGCTGTAGGAGGTGGCGCGGGCGGTGCCGGCCTGGGCGGCTACAGCAGACACAACTATTGACTCCCGACGAGGAACTGGAAGCACTTCG
ATGTGAGTGAGCACCACTACCTGGAGCATGAAGAGAGCCGTCGTCACGCGTGCCGTGCGTAGATAGTGAGAGCAGGAAGAGAGAGAGCGAGAGAGGCTGT
TACATGAGTGAGTGACCACGAGAGCCAAAGTAAGTGGAGCTAAGCTGCGTATTCCGTCCCCCGAAGCAGCAAACAGGCCCGTCCAGTGGACTCCAGCAGC
AAGTAAGCACCAGCAACACACAACGTAAGCCATTATTTAGATCTCCATAAGCTCTGTACTGCGGTCTGTGCGTCGTCCTTGGGTCTATTGCTGCACGCCG
GCGCTGGCGCCCGCCTGGTCCATGATCTCCTTCTCCACCTGCGCCATCTTGACGCCCAGCGAGCTGTAGGCCTGCATGTACTTTCCGGCGCAGCGGTCAA
TGCAGCTCATCTCGCCCACGTTGAGCTGGCCGTC