Description :
From Genome Similarity Track
Location :
contig_11:915940- 917074
Transcript NameFunction/comments
g3401.t1hypothetical protein
g3402.t1hypothetical protein

Sequence
1134 bases(100 bases per row)
GCTCAGATGAATTACCGCTTCCCACAGTTCGTACCAACGTCGCTAGCGCAGTTGATTCCGCACGCGAGTCCAGAAGCACTCCAGCTCATGACAGACTTGC
TCAAATACGATCCAAACCAGCGACCGACATCAAGTCAGGCACTGCAGTACCCATTTTTCCAGGTGAACGTGAACGTGACCGTGCCGTTGACTGTATCAAC
ACCGGGTGGGAGCAGCCAACAGCAGCAGTGTGAACGTGTGGAGTCGACTGAAAAGTTGGCCGCTTTCACTCCGCCGCAAAAATCATCAGGAAGTCAACGG
GGCGGGAGCGGACAGTATGGACGGAACCAGCAACCGGTGGTGGACGTCGGAGGATACAGCAGCTTACGGCAACATGCTACAATCACGTCAGCTTCGTCGT
ATGGCATGCCACGGGTTCCCCTGCGGAATGCTATAGCAGCAGCAGGAAGCAGCGTGCTATCCGGTGGGACACCGACTGGTATGGACAGCGGAAACATGGG
CGACGCACAGGGCAGTCGCTACACGCGACAGGCAAGATACGCGCCAGGAATGATGTACCGAGGCGAAGGTGACGGAGCGACGTACTCGGGCGGTAGACCA
CCGTACGTACCGCCGGGTGTCAGTGGTGGACTTCCGTTGGCAGCTGTAGGAGGTGGCGCGGGCGGTGCCGGCCTGGGCGGCTACAGCAGACACAACTATT
GACTCCCGACGAGGAACTGGAAGCACTTCGATGTGAGTGAGCACCACTACCTGGAGCATGAAGAGAGCCGTCGTCACGCGTGCCGTGCGTAGATAGTGAG
AGCAGGAAGAGAGAGAGCGAGAGAGGCTGCTACATGAGTGAGTGACCACGAGAGCCAAAGTAAGTGGAGCTAAGCTGCGTATTCCGTCCCCCGAAGCAGC
AAACAGGCCCGTCCAGTGGACTCCAGCAGCAAGTAAGCACCAGCAACACACAACGTAAGCCATTATTTAGATCTCCATAAGCTCTGTACTGCGGTCTGTG
CGTCGTCCTTGGGTCTATTGCTGCACGCCGGCGCTGGCGCCCGCCTGGTCCATGATCTCCTTCTCCACCTGCGCCATCTTGACGCCCAGCGAGCTGTAGG
CCTGCATGTACTTTCCGGCGCAGCGGTCAATGCA