Description :
From Genome Similarity Track
Location :
Scaffold_7:9158- 10178
Sequence
1020 bases(100 bases per row)
TAGTCCCCGAAGAAGCGCAAAGACTGACTGTGTACTAGCGCTGAGTAGTGAAACAACTAGTTCGACTCTCCCCAGGCATAACACTGACGAATTCTACGAC
TTTTCAATAGTGGATGACCTGTAGCCTAACCTATTATGCATACCAAAAGTACGAGTTCAGACCAACAAGTACGTGTCAAATTTACCAAGAAATACGAGTC
ATACCAAAATGTACATAAAGGTCAGAATAAAACATACGGTATTTTGTTCAAAGCCTACAATTATCTACCTATAGAGACGCAGAATACTCTGATAGGTCCT
CGCTCGGGTGACAAACATCGTCACGGTTCTTGTGATCCTTTTTGATGAAGGATGCTAGTATGGCAATAGTGATTGCGTGACACGTATCAGAGTCCTCGAC
GTCGATGTAGTGTTTGGCATAGCAGCTGTCAAACACAGGGATCACATGATCCTTCCACCGAGCCTGGTCCATTTCGTTCAATAGCTTAGCGAAAAGCCCG
ACGTTTTCCCCCACCAATTTAGCAACGCTGTACCGAGTGATTCCAGCTCTGGCACGCTCAGCTTTGGTCCATTTTAACAGTGGCTGGAGAAAATTCAATG
ATTCGTCTGGAAGCCGCCACACCAAGCATATTTGGGCACAATCTTTTATAGCGGGAAGTTCCAATGTTGTTGGCTGCTCGGACCGCTGTCCTGTGTCTTG
CTCAGTATTTCCTGGGCCTGCTGTCCTGAAAGGGGGGGGGGCATTGGTGGAAATCGCCAGCACGCTGATTTGCGTTTTCATCGTTACAGAACCGATCCTT
CGTTAACATTCTTGTTCGCCTCATAGGGAGCACAAAGATAACTGTGCAAATATAATTTGTCCAGCGCCAGACAATCTGCTAGCTCACTTTCTTCCGATTG
GATGGTAACATCGAGAAGGTATCTCACAAGCGTCTCAGTGGATTCGGAGACACTCCACCCAACCCACCATTTTATCGTGCACAGAGACGAGCGACACTTA
GGTTTTGTATACATGAATCA