Description :
From Genome Similarity Track
Location :
Scaffold_7:9157- 12083
Transcript NameFunction/comments
g5750.t1hypothetical protein

Sequence
2926 bases(100 bases per row)
GTAGTCCCCGAAGAAGCGCAAAGACTGACTGTGTACTAGCGCTGAGTAGTGAAACAACTAGTTCGACTCTCCCCAGGCATAACACTGACGAATTCTACGA
CTTTTCAATAGTGGATGACCTGTAGCCTAACCTATTATGCATACCAAAAGTACGAGTTCAGACCAACAAGTACGTGTCAAATTTACCAAGAAATACGAGT
CATACCAAAATGTACATAAAGGTCAGAATAAAACATACGGTATTTTGTTCAAAGCCTACAATTATCTACCTATAGAGACGCAGAATACTCTGATAGGTCC
TCGCTCGGGTGACAAACATCGTCACGGTTCTTGTGATCCTTTTTGATGAAGGATGCTAGTATGGCAATAGTGATTGCGTGACACGTATCAGAGTCCTCGA
CGTCGATGTAGTGTTTGGCATAGCAGCTGTCAAACACAGGGATCACATGATCCTTCCACCGAGCCTGGTCCATTTCGTTCAATAGCTTAGCGAAAAGCCC
GACGTTTTCCCCCACCAATTTAGCAACGCTGTACCGAGTGATTCCAGCTCTGGCACGCTCAGCTTTGGTCCATTTTAACAGTGGCTGGAGAAAATTCAAT
GATTCGTCTGGAAGCCGCCACACCAAGCATATTTGGGCACAATCTTTTATAGCGGGAAGTTCCAATGTTGTTGGCTGCTCGGACCGCTGTCCTGTGTCTT
GCTCAGTATTTCCTGGGCCTGCTGTCCTGAAAGGGGGGGGGGCATTGGTGGAAATCGCCAGCACGCTGATTTGCGTTTTCATCGTTACAGAACCGATCCT
TCGTTAACATTCTTGTTCGCCTCATAGGGAGCACAAAGATAACTGTGCAAATATAATTTGTCCAGCGCCAGACAATCTGCTAGCTCACTTTCTTCCGATT
GGATGGTAACATCGAGAAGGTATCTCACAAGCGTCTCAGTGGATTCGGAGACACTCCACCCAACCCACCATTTTATCGTGCACAGAGACGAGCGACACTT
AGGTTTTGTATACATGAATCAGTATTGAGCTCCAGCGCGACGAAAGGTGTGCAAAGTAAACCAGCCGTTCGACCAGTACATGATACATAACCCGAAATCT
GTTTACCAAATCAATTAAGGTCACGCACGATGCAATTGAAATGTGTGATGAAATCATGCTCATACATCTGCTTCCCCCAACCAACGGACACCCTCTCACA
ACCTGTAGCTTTGTCGTGTGTCTTGAAAACCCTCTTGCTGGCGCTGGTTCGTGCTGGAAACACGAAATCATCATCGCACCTTTAATGCCCCTTCGTATTT
GAAGCATAGTCCACCGAAATGCACAAGTGCGTGAAAGCACTTATAGATATTTCATTCTTTGGCACGTGGTGCAAGTTATACATTCATCCTTCAGCTACAG
CCGTCTTGAGATTGAATCGCGCGTACGTCCCATACTCAATGCCTCATCTGGAGCGACGACACTGGAGCGGTACTGCTGCTGTGACAGATCCTGTCACTTG
CGCGTCAAAACCTCGTTAATATGGCATAGGCCGTAAAACGCAAACGAAGAAACAGCCTTGAGCCAAACACGACTTGCTTCACTGAAACCCGCAACACCAC
CCGGAGAATCAAGAAACGCGTGGAGAATGGTAATCATGTCGAATAAGATGGGTACCGCTTTCGCAGGCACATAGAGCCTTTCTTCTTTTTCAGTCCACAT
ATGAATTGGCGTACGAACGGGTCTCTGGCTGGATTGCCGTATCTATGCTTTTCTCCAGAATCACCTTCCCGAACACACCACGTGTTGACGTCGGTGCCGT
CACTGTGTTCATGAGATGAAAAGTAGCTAACAACGGCAGACCTTGCCTTCCCTGCTATTTAGAGCGAAATGAAACTGGAAGCTGAGATGTGTTCGGTTTC
CGTCGGTCAAGACATCGAAGACGTCGCCAGCCAAATGAGGAAAGCTGTCTTTTTCTGATCGAGAGGAGTTGCGCTTGGAACGGATGAAACTACTTAGGAT
ACGAAGGAGCGAGGCTGGCAGCTCAGCTGAGTTCAGTTTTAGGTTTTCTTCTTCTCGACCCACCACTCCACACCCCGAGAATGCGATGAATAAAAGTCTA
CTTACCCCACGACCTCACGATCGCTGAAAACTCTGCAACTAAGCAACCAAGACAACAGGAAGCCCGTGATGCCGTTCTTCTCGAAGGTTGGGATACCGTT
AGTGACGCAGAAAGCTTCAGATTTCTAGAAAATCGCCTCGTAAACGGTCTCTGTGGCCTTCTTAAATGCTGGTCTTCTTTGGTCAGCTCTCATCAGATGA
ATTATTTGCGTGTAAAAATCGTCTGAAAAGTGTAGTCAAACAAATTTGTGCTTCTGATTGGTCAAATTCCACCAAACAATGCCCAAATGATGTATGAGCA
CAAGAAAGTTTCCGCCCAAACGTAGAGATATTGCTTCCTCGTACCGAATCAGCGCTTCAGACGGAGCAAAAGCCACTTTATAGGGTTAGGTTAGTTTCAA
TACAAATAGCAAGGTGTATGTAGAGAAGGCTACTATTGAGAGTTTTTTTTCAGGTAGAGTTAGCTCTACAACAATCGGAAAAAGGTGTTGTTCGTATAAC
TAGTGTCGGCACTATAGCTGAGATCTCATTAGTAGTTAATTAGGCCCTCGATCGGGGGGTTTCATACTGACACAATACTTTAATCAACATATACTCAGTC
GGTCGGCAGCTTGGTGATATTCATCCACCTGCAAATCAATCCCTCGGCTCATCTCATCAGGCTGATTAGACGTACATGTACAGCGTGTACTAGTACCTTT
GTACTAAACAACATGTACAGGTCGCCACATTTCGAGTTTAACGCTACGAGAAGCACACCACATGAAACGCTAAGATGGCATCTGCATTTATTACGACGGT
GAAAGTATTGACGACTATCGCACAGA