Description :
From Genome Similarity Track
Location :
Scaffold_149:91540- 93258
Sequence
1718 bases(100 bases per row)
CTACCCGTCTTTTGAGCTCGGCGAACGACGCTTTTGCTGACGCCAAGTCATCTTCAGGACCAAAGTCCGTGTCCTTTAGCTGATAGAGTACCGCTCCATG
AACACCCAAGTTCTGGATGAATCGGCCGTAATAGTGAAGTGCACCGAGGAAGGCTTGCATCCCCTTCTTTGATTTCGGGAAGGAGAGCTCGGCGATCGCG
GCTATCTTCTTCGCATCAGCGCGTACGTCACTCGGCGTAATCTCGTGCGACAGGAAATCAACCTTGGGTTGGACAAAGATACTCTTGGTAAAGCTGATGC
TAATTCGACATTCTGTATACCGGGCTAGTAGTCAGTCGAGTGTCTCCAAGCAGACGTTAAACGTCTTCCCCCTAAAAACAGATATCATCGACAAACGACC
TCCGTTTGAACATCGGGATCAAATAAGACCGGTCTGGTTCTCCGTTCGCGACCATGTCGCCGCCCGGTCCGTTGACCAGGTCTTGGACCGGATCGCAGTC
AGCTTGTGAGTGGTGGTCCGCTTCGAACTTCGTCAGCTGACCTGGCGTGGAATCGCCGACTCCGCCGAGCTCGACTCGGCTTCAGCAATAGCCATTCGTT
CAGCAAACAGCTTACATCCTCCCTTGGGTTGACCGTATCCCCATAGAGCGTTGTCGATGAGACGTTGATAAATCATAGGCGCATTCTTTAGTCCAAACGG
CATTCGTAACCATTCAAAGTGTCCAAGTGCACAGACGAACGCTGAGATCTGCCGATCTCGACGAGTCATCAAGACTGCCCAGAATCTGCTCGCAGCATCA
AGCGAGCAAAACCACAGGTAACTCTCCAATTCAGTGAGCAGGTCATCGACTAGTGGCATAGCGTATTCCATCGGCGTCGTAATCGCATTAGCTAGTTTTT
AGTCAATGCATAGCCGAATATCCACACCATTTTTCTTCAGCACTATCACCACTGGTGAGGCCTAAGGGCTGCCCGAGAACGATATCAACCCAGCTCGAAG
CAGCCCCTTCAACAACTCGTACAGTTTGCTCAAGTCGCGGAGAGGTACCCGCCGAGCTCTCTGCTTGATAGGTGCGTGTCCTTGAACGTCGATGTCGCAC
AATGCTCCGTACGCTGGGGGCAGCTGGGCATTACCACTTGAAATTATTATTCCTTCGTGTTTTTGCAGCTTTGTTACCAACCTAGCCGACTGTGCTGGCG
TATGACTACTTGACTTGACGTTTGGTTCGCCATAGTCGAGTTGTGTAGTCTCAACTTCAGTGAGGTCGGGAAGGAAATCCAGCTCGTGAGCGTAGTCCGT
CAACTTTAGATCTGTCCCACTCCGCTCAAAGATATCGGCCTTACCGTCGTCTACATCATCCTCTTGCTCGTCTTCGGTCGCTGCGATAGCCAAGTAGTGT
TGTCTTAGGGTTTCCGTTGGGTCTCTCGTCGAGTTGCATTCATCATCTTCAGCTTGTTCTAAACCGTAGCCAATTCCGCCGGGGTCGAACACCGTCGTCG
CTGAGTTCGTTACTCTGATCTCAGTTACTGTACCTCCCAACAGTGATACCTCTGATAAATCATAGTTGTCGTCCACGTCAGGGCCCGTATCCGCTGAGTT
CACTACGATGGCCGATCTGATTCCTGCGTGTTCAAACTTGTCTCCGAGGTAGATGGTATCATCGTCATGCCGTCTAACCACATCCGAACAGATTTCAGCT
TCCATAGTCTCAAACGCT