Description :
From Genome Similarity Track
Location :
Scaffold_85:91533- 95484
Transcript NameFunction/comments
Physo_140396hypothetical protein

Sequence
3951 bases(100 bases per row)
GGTCGCTCGACCGCAGGTATTGGAGGTCCCGCTGGTGCCTCCTGGTTCATCTGTCGTGGCTTGAAAGGCTAGATTCAGCCATTCCATGTATCGACGAGAT
CCGATCGACACATATCCTGGGATCCGGGGTATCCGATCTCCAGCCTGCCATATTTCGATCCGTTCGTTCCGATGCAAGACGAGGTCTTTGTCGCTGATGT
TGGTAACCTGGAGATATCTGATTCTGCCGGGTCCTCTGACCACGGTCGGCACCCAGCGATCTCCACGGGTGATCCATAGCTTTTCTCAATCCGTCACCTT
CATTCGTAGCGGAAGTTCGATCGAATCCCCGATCGCGATCTGCACACACATACGTGTCTGACATTGTCGTTGTACAGCTGGCGCCGTCCGCTAAGCTGGA
TCTTGACTTCGTCGGGGAGACAGCTGGCGCCGTCCGCAAGATCGAGGCGGATCCCCGCTGGGACCATAAAGTCCATACCCAGGATCGACTCTTGTCCTGA
TAGATCGCCAACCCAGATATCAAAGAAATACACCAGCGATCCCGCCAGCGTAACCTTGATCCTGGTCCTTCCTTCCGTCATGTACACGCTTTCGCCAATC
CCCACACATTCCTGGCCCTGACTCGGGTCGACATAGCACCCCACCTTACGAGCAAAGGCGGTGTCCACGATGGACACCTCGGCGCCGGTGTCTAAGAGTA
AGATCGACTTCTCATTGTTGATCTTGCCAGTGATCTTGGCCTGACGGAACCACTTACCTGGCGAATGATGTTTCCCGTACCCCCTGGACTCCCCAGGAAG
GAGATCGGGCACCACATCGCCATATCTGCGGTGTTCGCTGACGCGAGGCAGACTTCGATCGGGATCACGCTCCGGGATCTCGGTCGTCACTTCTCCATCA
GCTGGCTTGAACCATTATTCCGGTCTGCGTTGCTTCCAATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAGGGCACTTCGGCGTCAGAACGGCTGAAGT
CGTCCGATCGATGTAGACTTAAGACCTTGGCGGTAGATTTCGCATGCAGATCACATGTATTACCGCGTAGATCAGTCCGTCCACTTACTCGATCTACCGT
GTTCTTGTTCACGAATGCATAGATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCGATCG
CGGGCAACATGCCAGCGTGCTTCACCGGGTTGAACCATTGACGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCCATCTCGTGTAGTTCACCACA
TCCACGGCACACGAACAGGCAACGATCCGCCGGATGACCTCTCTTGCCACACTTCTCGCACGTCAAACGACTCCAACAATCGAGATCGGTGTGTTTCCGC
GATCCACAGTGTGAGCAGCGGCTTGATTGCTCCGATCCGTCAGGTGAAGATCGCGATCGTGGATCCGATCGAGGTGGGTCATGGTTGATCTGCGCTTGGT
TGCTTCGATCCGGCTTCGTCGCGTCGCCCCCAGCGTTGCGAGACTTGTCCTCGGCCGACGCTAGGTAAACGCGACGTAGATCACCCCCCGAGTCCGATCC
GTCCGATCCTGTGTCCGATCCAGACTCCTGACTCGCGATCTGAACTGCACGCACTGCCCGCTTGGTTGCAGCAGCTGGTGCTGAGGTCGGAACCTTCTGA
CGATACTTCGATCCAAAGGCAGATCGCTTCTGTCTGCTCTTCGCGCGCTCTCGAGCGCGCAGGACTTCCTCCAGATCTTCCGCGTCCGAAAGCCGGAATA
GGGGAGCTGATCGGCCAGTTTCGGATCGCCCCAGCGTCTCGATAAAGTGTTCGACATGTTCTCGGCGGGCCTTGGAATCTCCGTCCTTGATCTTCAATCT
CGCACGCAGAGCCGCCACATTCAGTCGATAGAGGTACTCCAACGGCGATTCATCTGATCTCTTGCGAGAATGGTAATACTGCCAAGCGACCGATACTCCC
AGGCCACAATACTGGATCTGGAAACTCCGAAGTAGATCGCTCCACTTGTTCCGCGTCGATCGGCCCAGCTGGCGGTACCAGTTCTTCGCCGGGCCCGTCA
GTAGATCAGCGAAGGTCAGGCACTTCTCTTCGTCCTGATCCTTGCCACTGAACTCCTTAAGATCGGACATCGCCGAAATCCGCGCACGCTGGATCAAGGA
GGACCCAGTGGATCCTGAGGCAGCGGTGGCCACCGCAGCAGGGGCCGAACTCGGTAGATCAATATCGTCCGGATGCAACACCTTAGCTAGCCAGGCAACT
CGCGCTATTAAAAGTGTAATGCAATTTGATTATCAATATCGTCCGGATCGTATTCCCACTGGGAGAAATCTTGATCCGGTGATCCGGCTGATTCCATCTC
CACGTCCCGCGATCCAACGTTGTCGTCGACCACTGGAGTAGGTGTTACCACCGTGGCCTGTTGTTCCTTCGGAAATCGGGTCATCGCAGCCTGAAAGTAA
GACTCCAGTCTGCCATTCGACTCATCCGATCCGGTGGCACTGGTGGTCCGATCGGTCGACTTGGGGTTCTGCTTCCGAGGTCCTGATCGCATGCGTTCCT
GACGTTGACTCCGTGATCGTGCGTCCAACATCGCAGATCCTGAAGGGCCAAGGGACATCCGTTGAGGTTCAGACGACGTATCCGATACATGTTCCGCTGC
GGAGACATAAGGAGACGACGATCGGTACCCAGTGGACTCCATCCGCGGCGACGACGCGGGAGCTGGCGAAACTACATCTGGCACCTTCGGGTCCGGACTG
TCCGCGATCACGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCTGGATCGCTGTCTGGGTCACATCTTGATCGAAAAGATCGTTCGCTTCAAAGGCGC
CAGCCACGAAGCCGGCTTCCTTCAACAGCCCGAGCAGGTTCTTCACCGCCATCAGCTTGTTATCCGTCACTCGGGGGGCCGAGATCGGGCCCTTCGGGTC
GTCGATCTGCTCTGGCCGCACGACCACCATGACAGGATCTTGACGCAAGAAGTCTCGCAGTTCCTCCAAGTGATACTGACGATCCAGGTCAGCCTCAGAC
CAGTCGAGCGCCGACGGTCTGGGATCTTCGTCGTCCAAGCCTGGCGCTCTCAGCTTCTTCCTCACGATCTGGGCCTTGTCCGCGATCGCGTCCAGGTAGC
CCGGATCGAGCCTGATCGGCGAGTCAGCGAACGCGTATCGGTCCGATCCCGCCTTAGTTTTTTTTATAAGTGAATCTCGGTTCGCACCAAGATCCACCGG
GGTCCCCGAAGGGACCTGGGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTCCAGATCGCCCTCGATTCCGTCGACAGAAGTCCTCCGAGCACTCTGT
CGATCCGCGGATCTTACTTTGTTCAGCAGCGTCTTCGTCGATCCGATATCCGACGACGCCTCTTCCCCTGGTTCTTTCTTCACTTGCGCATCTTCTACGG
ACTCACGGTGAAATCCGGAGTCCCCAAGAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGCCTGATCGAGCTTCC
CACCAGCGCCCAGACACCGACTAACGGAGGGGGTTCTCCAATGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCATCGGCGGGCTGGATCTG
CTCTCTCGGGGCTCCGAAGATGCAGCACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGATAGTTTGTGGAACAGCGCGGTAGTCTTCGCTCTGCG
TCCGAGTGTATGCTCCGATCGAGGGTTCATCGCTTCGATCGGTCGGCCTGGAGTAGATCCAAGGCCTGTAGTTGCCTTTCCGGGTATGTTCATTCCTTTC
CTGAGTTGCTTGCTGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGA