Description :
From Genome Similarity Track
Location :
Scaffold_61:91509- 98875
Transcript NameFunction/comments
g13907.t1RAW43717.1 hypothetical protein PC110_g141 [Phytophthora cactorum
g13908.t1hypothetical protein

Sequence
7366 bases(100 bases per row)
GCTGAGCCGGAACTTCCGCACGACGTACTACAAGACGCTGGGCGTGCCTGTGGTGCAGCACATTGTGGACGTGGACGCGTCGTTCGCGGCGCTGCTAGGC
GAGAGAACGGTGAACGTGCCGCAGCTGCTCAAGTTGGCGCTGGAGTTGGGCATCGCGCCGCAGTACCGCGCGAGGATGTGGCTGCTGCTGGCGGGGGTGC
TGCCGCCGTATCCGGGACTGTGGACGTTTGTGTTGAGGGAGCGCCACGCCATGTTTGAGGATGTGGTGGGCGCGGCGCAAGTCCTGCAGGCGAAAGACGT
GAGCGAAGGAGACGAAGGGGGCGGCGTGTACTACGACTTCTCGGAGCTTCTTGTGAAGGATGAAGACGATGCAGAAGATGAAGTTGCAGGGAAGACGCCA
CGACCTCCTTCGCTGCAGGATTTGAAGAGGCTGGTGCACTTGCATCGAACATATTGGAGAGAGATCGCGGCGTGTGACGCGCCGTTGTTGTGCGGGATGG
ACGACCCGAACTTCTTGCTGGGCGTGGCTCGAGTGGTGTGTGAGGTGCTGACACAGGCACCGGAGCGGTTTTGGTGCTTCACGAGGTTGCTCGAGTTGTT
TCATGATGGTCTGGAGCTTGTGGATCCGATGGTGACGGTGGACACGCTGTACAAAGCACAACTGGCGGACTTTGAAGCCGTGTTTCTCCGTACACTCGAC
GTGAAGCGACGTCGTCTGACTGCTGACGGGTCCATCTCAAGTATGCACGTGCTCAAGAGTGGCCATGATGAGGAGCATGGGCGACGACGGTAAAAATATC
AAATAAGCTGCATGGTATTCAAAACAACCAATCCCTCATGGTCAGTTAAGCAAAACCTTCGACGTTCTCGTCCTCATCCGCACTATCGCTCTCTGCGACT
TGCTGCTTGACAGCAGCCCTGCGTGAGCGACGTCGCCGCTTCGGTGGGGTCTTGAGTTTCAATTGTCGTTCCTTGGGTTTCTTCTCCGTTTCCAGATCGA
AGTCCAGCTGCGCTTGGTCTTTGCGAGCTACGAGCCACGCAGTCATAAAAAGATTCCAGTTAATCTGGATAGGATCTTCCGCGTGAAAGAAATCGTCGAC
AGAAGGGAGCAGGAGTTTCTTGGGGGACCGCTCTCTCACCTCTACAGATTTATCTGCCGTAGAGTGTTTATACGTTGCGCACTTTTCGTTGTCCAGCTTG
TAGTTGGCCTTCAGCGCAAGCTTCAGATGGAGCATCAGTGCCAGTGCGAAAGCAGTGCACCCGTTAGTCTCCAGAGCTGCCAGCTCGGAGCCGGTTAACG
GAGATAGTGGGCGGTATTTGTCGATATCAACTTGTGAGAGGTTAGATTCGTCGTCCTCCAACTTGTCAGCCGCTACACCCGCCTTCGCAAACGTTTCCCT
GAGATCGTCCAGCACAGGGCTAACGAATAAAATAAAACGAAAACACCAGCGGAGTGTGAGATACACGCACGCCCTAAAACTTGACAGGCTACTACATGTA
CGTACCCGAGACGAAGGCTCGCATAGCGGTTGATCAAATAAATAATGTACAGCGGCTCATTCTCCACCTCGTACGGTAGCGCGGCAATGATTTGTGCCAG
GTAGCACAAATATTTCAGATTGCCCACGGTGATGCTGCTGTTGGCGGAGGCAGGTTTGTTCTGTGTCTTTAGAACGCTTCCCTGGTCAGTGAATTGATTC
ACGAGCGCCTGAAGGAAAACGAATCTCGTTGACTTAAGGCAAGTCGTGTACAATCGCCCGAAAAGACAAAATTCTTTGTTGTCTTTCTCGTCCTTCTTGG
GCCTCGAAGCTGTAGCGGTGCCGAATACTCTCAGTTGAAACGAGTACGAGTCCCGGATGCCTTTGATAGACGGCGTGAGGAACTGGCTTGGGAACCTTTC
ATACACCGCCAGCAGCTGAGAAAACGCAGCATCTCGGACGCCCAACACGCCATCCGTCTCCAACGCCACCAAGTTCGGAATGCATTGCAGTGGATTCACT
AAGCCTTGTGTTAGTAGTGCTCCAATGCACCCGACCGCCTCCTGTCGAATTTGCGCTACTTTATGCAGCGATAACAGCAATACATTTCCTAACTCCGCTT
GCATAACGTTGCCAATCAACGAGGCGTCAGCTTCCTGGTCGCCTTGAACTTGCTGTTCTTTGCTTTTGGATCGATCCATCCTCTGCGTCGCCAGTCCATT
TCCCAGTCGCTGCTCTTCGTAAAGTAACAGCTCCTTCATGCTTACAAGGCAATGCAACGTCAACTTGCCAGGTGCTGCAGTTAACAGAAACTTCAACAGT
CCATCTTGCTGAGCCCGTAAAAACAGACGCGGTCGAATAGGGAACAAGAATCCCATGCCTTGAACAGCTTTACCGGCGCATGCATCATTGCCTGGCTTGC
GAACATATTCTCTGTACCACTCATACAGCAACTCTGTGATCGCCCCAATCTTTAGCAGTTTCGCTTCATTTGTCAACTCCTTGTGACGGTCAATATCCGT
CGCTCCCACTATTTTTCCCGCAGCAAACAGTGCTCGCTGAAGAACATAATTATCTTTCTCCGATAAAGTGGTAAGCGACTCCTTAAGTTTGTCCCGCATA
ATTAGGGAAAACTGCTCCAGCAATTTAAGGAGCAATACAGGAGCCATTTTCCTGGTTGAGGACAAAGTTGCTAGGCACTTGACACTCGGATCAACGACAC
TTGGGGGAGATCCCAGCACTAGGAGCCTCAAATCATCTTCAAGCTTACTAGCAAGAGATTGTGGGGGCCTCTTGACACTCAAAATGTGGTCAATCATTGA
CACCGCGAGCCTTTGGATCTTGAAATCGTCCTCTTTCAGGTAAACCCGAAGAGTCTCGATATGACAAGCCAAAATTTGAGGTTTTGCTTCACAAAAAGCA
GTCAAAGCCTTCATGCACGATACAAACTGCAAGTGACCTTCTTCTATCGAAACACCCTGGAGCAGTTTACCTTCCTGGAGGTCCATGAGGCAGGCAACAA
GTCCGCCGACAATTTTCTCGGAGCGATCTTGTGCAATTTCAGCTTCATTCTTACTCGATCGCGATACCTTTTTTCTCGTGCTGTCAGTACGTTCCTCCAG
CAGCCGTTTCAACAATTCAACGAACCAGCTAAAGTTTGGCATGCCATGGATGACTTCAACGATAGTTGCGACAACTTCTGACGTATTATCCATCTTGGAG
TCAATAATCTTTACCACACTAGAGGGAGCCACAGTAGGAGTTCGATACGCAGACCACGCTTCCTCGACTGAGTTGGCGATGTTCCCGCCTTCGGATACAA
ACTTCACATTTTCTTGCGATATTGGTGCAGCAACACCCTTCTCGTCACTTGTACTCGCAACAGCTGCCCATCCAGGTGGAAGATTGCTTCCATCACCAAA
CTCGCCGAGCGGGTTAGAAAGTCGGGAGAAAGCAAGCTCGGCACCGAACCAGACTTCTTGGAAAGTGTCAATGATGAAGTTCTTCACGCCTTGATCTTCA
GCTGCATCTCCAATTCGCTCAACCAGGCACTTCATACAAGCGCTCTTGCGGCGGAGCTCTTGCTCCGAGATTGCATCACCAGACCGATTTTGCATTGATA
TCAACACTACCTTGAAGATCTTGCACACACTTTTGCGAACTTTAATACCTTTGTCTCTTAGCCTCTCTGCAAGTGCGTCGAAATATTTGTCGAACTGTTC
ATCAATGAAAATCACCACCGTTAGAATTAGAGATTGGGTGGATATTGGACATAACGAGCACGAGTCTTTCGTACCAGAAGGGGTTGCAGCAGAACGTAGG
TCCCAATTAAATCCACGGCAGCTTCACGAACTGAAGGTTTTTCATCAGAGCAGCACATCTGAACGGCTGTCTGCACACCGACTTCGGCCATAAGCATGGG
ATCGACGTCGACAATTCCTCGCAAACACTTCATAACACGCGCTCTTAGCGTTGGGATTCCCTTGGACAACAAAGCCATGACGTGCGCAAGCAAGCTGTCA
AACAAACCGCAAAATCCACGTTTTACTGCAAGATGCAAACTCGATTTCAACGCCAACTCATTCGTAGGAGCAGCCACCTTAAATATCGAGCCCACACCTC
CATTTCTCATTTCCCACAAAGAATCCCATAATTTTCTCTCTCGTTCTCGATAAACTGACTCGGCACTGCCCCAATGTGTGTCCAACTCCGACATGAACTT
CAAAAGAAGCAACTTCTTTGAATCACTCTGACCAAAGTTGTGTCGTTGAAGGTGCATCACCACGATATGCTTCAGCGCCATCTGCTGACACCATTGTATG
CTAGCTCTCGGTAGGGCACTTCTGGACCGCGTTTTCTTCCCAATTATTGCTGTGCGCAGGGTACTCATATGCTCTTCAACGATCGCAACAGCATCACTGT
CATCTTTCACACCACTATGGCCGACCTCTTTCTGGTATCGCTTGATTGAAGCGCACATCTTCCCGACCAAGTTAAGTGCAGCCAGGCTGTAATGTGAATC
TGGGCTTTTACCTTCCTTGGAGATATTTGCGTGCAGGATACTTGCCAATGAGGAGCTCAACACTTCGAGGAGCTCTTCAGCGCCTACCCATTCCGGGCGC
ACAAACATTTCCAGGAGGTCTTCAACAAAGTTATCCAAGACCACGCGGTTGTCACGCTCTTCGGACCTTTTCCAGCATGCTGCGAGCAGCTTCCCAACAA
ACGACTGCGCGCTCTTTCGTGTTTCGTCCAATACGGCCGCCACGGTACCATTTTGCTGCTGAGACTTTTCGTCAGTGACAGTATCTGGTGTCGACGAAGG
TTCTATTGAATCGTTCAACAATTCAACGTCAGCTTCCGCTGTCCCAACTTTGACAGCTGGCGCGCAAGACTGAATCATGGACACCGCTACTGTTGATATT
TGCTGCACCATTTCGACTGAGTTAAGTAACTTCATTGTTCGCAGCGTACGCTTGGTAGTAGGTAGCTTTACCATGACTCCAACTATATCGGCAAGAAGTG
AGTCTCGGTGAGTCGGATACTGCAGGAAGATGTTTCGAAGCACTACAAGACCACTTTGTTGTAACGACGTAGCATATGTGCTGTACTCCAGAGTAAACAA
CTCAACCATCGAAGAAGACAGAGGTAATAACCACCGGTCAGCAAGTTTCACACCTAGCACAAGTGTTGCGAGGTGATCCATGAGCTCACACACGACGTGG
GTAACCCCGCTAACAGCCTCACGAATGTTTTTGTTGGTACGCAGATTTACACGAGAAGAGCTCGATGTTTTGCCACCCGTTGACCGGCTCTGATACTTTT
CATTTCCCACTCTTGCCGATGCAGTTGTTGCAAATGTGGTATCAATGCACGGAAGTAGCAGCCGACGAATAATGTGATGCAAGAGCAAAAAACAGTTGTT
AATAGTCTCCTCGGAAAGAATTCGGCGGTCAATCTGCGGTGTTGTCATCACAATCAGCTCACAAATGGCGACATCGAGCGATGCTATGAGACGTTGAACT
AGTCCGTCGTTTGGCTTACAGAGATGGGACCTTTTCTCTTCATTGCTCGGCATCATGGCGGCAAGTACATCCAACGTCAAACCCAGTTGCACCTGCGTAT
CAAATGCGCTCATCAACGAGATCAGCAGCTCTGGCTCCAACTTATTAATCCAATCATTCTTTTCCATGGCTTTCAGTGACTGCAGCAGCAACTTCACTTC
ATCTGACGAGAACACATCCTGGTCACCCAGTTCAAAATCTTCCTGCTGTTGGCGATACATGGCCACATCAACCAATTTCACCAGTAGCTCAGCATACTTC
TCCACACTGTAAGCAGTAATCTCCGCTTGAGTAGGAAGTGCTGGGGGCTCTGCTTTGTCTTCCACCTCCACCTCCACATCGTGCTCGGCATTCAATTCAT
CCAAACAATTTTGCAGCTCGCCACCTTCATCGTGCATCGAGCTCATATCATCTGTAGTGTTTCTAACTGACTGCCTCTTACACGGTTGTTCGTACTCCGT
CTCATTCTGCAGCTCCAGACGTCTCTTCAACTTGTTCGACGGTGATGCTTTCAGACCACGCGCAGACTCAGCTACATGTAGCAGCGTCCAAACACATTCA
CCGTTAGGTCCGCATTAGCAGTAGTTGTAGTACTATACACAGCTCTTGATTCTCGACAAACCATTGAAGCATCCCGTCTGCACCACCGCCTGCGCCCACT
TGGGCATCGAATTTAGCACATCTGCGTCGATTTCCGTCGTCTCACCCACAGTACTGCAATATTCATCGCCAATTCACAACAAATGCCACGTTAATGCATA
TTATTTACTATACATACTGAAGTTTTTACTGTTCGTACCTGAGTCTGCCGGCGTTGGCAGTGCGGATAAGCGTCGCCATCCGCTGCGGGTTGAAGGTCTC
GGCGCCTGCCACGGGCTCCGCAGCCATAGGATGCACCATCTCGCGCGCATCGGCCGCCACCACGTCCTCCGTGTCCACGTACAGTGGGAAGAGAAACAGC
CCACCCTGCATCGTCCTCGGCGAGAGCACACCCTTCTCTGCTTGTTAATGCGGAATGTGAGTGATTGTTTCCTTTGGTAGAAATGTGGTGTATGGTACAC
CACGTATCTGCTGTCACTTAGAAACGACCTAACCTGCACTTGACGATGGATAAGGCCATTAGACTTAAACTGCAACAATTGCAGTCTTACTCGACTTTCT
GGCGCGGCCTGTGCGCCGGACGCATTTTCCTCTCACCAGACGAGAGAACTCCTGAGCGGAATATGGCGCATAAGATGCGGACCTGTTGTCGTCGTGAGCA
ACGTAAAGTACATGTGCGTTAGCACCAAAGATCACATGAGGCAGAAGCATGAATATATATATAAAGAGCATCGCTCACAATGTTCCAGACCCAGATGCAG
TGCAGAAGCAGCTTGATCGTAGGCAATGGAAGCACTTCTCCGGCTCCAGCGAGCCGCTTGACCGGCACGAGAACGTCTCCGTACAGCACTAGGGCTGACA
CAAACAGCACTAAGCGGATAAACTGTGCCAAAGTCCGAGTCAGCCGCATTTTCAACGTGATATGCTTTAAAACCTCAACGTACCAGCGCAGTACTGCGGA
AATACACCAAGAGAGTTGCGGCTGTTGCTCCCAAGCGCACCGCCTCCGGTTTATCGTAGTCTAGAGTGCAAGTCACCCCCAGTAGCGCGACCAACCCCTG
CATCGAAGCTGTTAGAACCGGCAACAACCAGGCGATCCCACCAGTGCGCAGCGCAGAACCCTACCAGTTGGATATAGATCGCGACGTCAGTTGCTCGGGA
ACGACCAGCAGTCGATGCTGGTCCCCACAGCGTACGGTCCAAGTCAGTGTGGTGAAGCACTACCAT