Description :
From Genome Similarity Track
Location :
Scaffold_125:91507- 92576
Sequence
1069 bases(100 bases per row)
CGTGTCTAAATTCTAATGCGGATGTAAGCCACCTGCGGGTTGGAGCAACGTGAATGCCTTCAACAAATAATAACACCATCCTTCTTGCTTAAACTTCAAT
CTCGCGCGAAGACGTGGTGATCAATTTCATTTCCTGGAGCAAGATCTAAAGCGCCATCGATATGAAAGATGGCCGGCATTAGATCCTATCAAGAGACAGT
GACATCCCGCTTGCCGCAGTAATCACCCAAGCTGTATTATAAAAGGATAGACTGGATATGCCACAAGGTCCAAAGAATGCTCCGACCACGTGCAGTCGAA
TGATGACACATGTACTTTTCCTTTCTTCACGTCAAGCTATTTCGACGATTTTTTTGCTCTCAGCCGCGCTGAGCATCAAGTCAGCACAACGGAAGTGCAT
ATTCCATACTGAACTCATTGTATCAAGCGATGCGTGAGCAAAAGCCATACGAGATTTGAAAAACAGTGTCTACTGCGGTCCCGAGACTCCTGTACTCTTA
TGCTATGCTAGCAAGGAAGTTTTCAGCGCTGGACCTGGGAAGGTCGCATTCAATCGTTCCTTGCAAATCCCCAGAATCCCGACTGAAATTCTCGATGAAT
CCGTCCGGAAATTACTTGCATAACTATATACGAAGGATTATGCTAAGATAATTCAGACATTATTGACGCTACTCAATAGAAGATGTTTAGTAGCGGTGTA
CAGAACACCAACATGCCTTCGAATCCGTCAAAACGAGAGCTTGTACGAAGTACCGGTGGTGATGCTACATGATGATACCAAGCCATTTTACGTCGTATAG
AAGCAATCCATTTTGCAATAGTATCCAACATTACTTAATTTAATGAAGAGGGTCGTGAGCGCGTCGTGAGTTTCCAGTCACGATATATGAAGCCTGTGCA
TTAATAAAGTGGAAATGCGTTACGCTCTGATGAAGTTCAGATCTGGTTGACTCGGTATAATAGTGTTTTCGATCATCACAGATCACGCCTCATTGCGTAC
CGCCGTTAAGAGGCCTCACATATCACGGCGTAAGCCTCAGTGGTTGTCTTTCTTCGCCGAACCCAATTT