Description :
From Genome Similarity Track
Location :
contig_11:914772- 915906
Transcript NameFunction/comments
g2732.t1NIPA protein 3

Sequence
1134 bases(100 bases per row)
TAGGAAGATGTAGGTCAGTCCGTACTTAAACTGGTTTTCGCCTTTGAGCGTGAGGGCAATCATAATCGCCGAGCATTTCGCCAACAGCACTGTCATTGCG
CCCACAATGCCCGAGCAGATAGCATAATAATATGGCACACGAGACTCTCGAGCTGCAGCTTCCTCGTCTGCCTCAGCATCATCCGCATTATTCGCGTCGA
TGAGCTCTCGGAGCTCTCTACTCAAAGCAGGGGGCTCACAAGCCCCGTCGGAAGCGCAGAAGGAGCCGTCGTGACTTGCAGAAACTTGACCTCCATATCC
AAAAGCCTTTGTTCCAGCCGCTGAACCCGCAGCTCAAATTCCTGTTCAGCAGATGCAGCACAAATAAGAGATGCACAGCAGCAGCAAATCCCAAAAGTAC
TTGGCAAACCTTCATGAGTTTCTTCTGGCGTCGATTCGACCAGTACACCTGGTTCTTCAGTCGGTTCGCAACGGAGCCTTTGATGGTGGCCAACATACCC
ACCGCACAAACCCCGACGCACGTGATATACACCACGAACGCTGCAACAACCAGAAAACAAACAACATCAGCAAAGAATCAAGAAACAGAACATCTCCAAC
TCACGCGTCCGGACGAATCTCGTCTCGAGCTCCGGCAATGGGTACTCGACGTTCGGCTCCGCGATGCATGCAATGATGACCACGCCCACAATCACAAACA
GCACGCCCCCCACGTCCGTCTAAATCATAGAAACACGCAAACCCTCTTCAATTAGAAAAGAAGCACAAAATAATTTAACTACCAACTCTCCATACCTTGT
AGAGTTGCTCCCCATTGAGACACTGCGCCGTGACAACATTGGCCACGAGCGTTGCGCCGCCCCCCAGCGCGGCCACGAGCGACTGCGTGGCGAACCCAAA
GGCCGCGAAGTCGCCCAAACTGCCCAGCGCCACGAGCGCGAAGCCCAACCACCACACGGGGCGGTGCACGTAGGGCCGGCGCTCACGCACAGGCCGCAAG
GCCTCGCTCAGGTGCGAGTACTTCTGGATGTTCACGCCCAGGTTGGACACGACGGACGCCACGACAGCCAAGCCGGCGCCGAAGGCCTCCCACGTCTTCA
TGGCGGATACCACAAGGTGAGGAATGAATGTCAG