Description :
From Genome Similarity Track
Location :
contig_4:914763- 916074
Transcript NameFunction/comments
g1534.t1XP_009533193.1 hypothetical protein PHYSODRAFT_520613 [Phytophthora sojae

Sequence
1311 bases(100 bases per row)
GCTGCAGCCGTTCCAGAGCGGTTGGTCCACCTCGCAGATGAACCTGTCGCAGTACAACGACACGGACGAGTGCAATGCTCGCCCCGTGGCCGAGGACACG
TGCCTCATGTTCCCTGGCCACAGCAAGACGGAGTGGACGTTCGCCGTGAACGCATGGATCTTCGGTGCCATGGTCGGCTCGCTGTGCTGCGGCTACTTCA
GCGACAAGTACGGCCGCAAGAAGGCCCTCATGGGCAACTGCATCTTCATGATCGTGGGCGGCGTCGTGCAGGCGGCCGTGTCGAACGTTTGGCTCTTCGC
CCTGGGCCGTCTCATCGCCGGTCTGTCGTCGGGTACGGCCACGGCCACCATCGGCGGCTACATCAACGAGCTGTCTCCGCCGCACCTGCGCAACACGCTC
GGCCTGGGCCTGCAGATCTTCACGACGATCGGCATTTTGGTGCCGGCCATCACGTTCTTCTTCGCCAACACGAGCTCTGGCTGGCGTTACCTGGCCGCGT
TCCCGGTGGTGCTGGCTGCCATCTACCTGCTGCTGGCGCCGTCCATGTGCGTGGAGAGCCCTGCGTGGCTGCTGACCCAGGGTCGCCGTGACGAGGCCAA
GCAGGTGATCGCTCGCCTGTACGGCGAGGAGCACGTGCAGACGGCTCTGTCGTGGCTGGAGGTGAGCAAGAAGGGAGACCGCGGAGGAGGGTCTGGCTGC
TCCCAAGAAGGAGTCGATGTTCGCGCCTCGCTACCGCCTGCAGCTTCTCGGCGGCATCATGCTGTCGATGGCGCAGCAGCTGTCGGGTATCAACGCCGTG
TTCTACTACTCTGGCAGCATCTTCTCGGACGCCGGCATCTCGGACTCGCGCGTGGGCACGCTGATCATCGACTTCATCAACATCTGGCCCGCCTTCTTCA
CGGGCGTGCTGGCCAACCGCTTCGGTGCGCGCAACATGATCCTGTGGGGCCTGTCGGGGATGGTGGTCATGTCCATCGGCATGACGGTGGCGTTCATCGT
GGACGTGTCCGCTCTGTCGATTGTGTTCACGGCGCTGTACGTGATCGTGTTCGGCGTGACGCTGGGCCCGCTCGTGTGGGTGATGACGGCCGACATTTTC
CCGGACTCGATCCGTGCCAGCGCGTCGTCGCTGTGCATCGGCATCAACTGGCTGTGCAACCTCATCGTGGGTGTGTCGTACCCGTACATTTCGGACGCTC
TGAACGACTACGCGTACGTTCCGTTCGTGGTGCTGCTGGCGATCTTCTACCTGCTTGCTCTGAAGCTGGTGCCGGAGACGTCGGGCAAGTCGGCCGAGGA
GATCCAGGCCG