Description :
From Genome Similarity Track
Location :
Scaffold_10:91457- 106877
Transcript NameFunction/comments
Physo_155999PREDICTED: similar to kinesin family member 11
Physo_130074putative RNA helicase
Physo_156002putative cationic amino acid transporter
Physo_10844626S protease regulatory subunit S10b
Physo_130077peptidylprolyl isomerase (cyclophilin)-like 6

Sequence
15420 bases(100 bases per row)
GGAGAACTACAGCTTGTCCCTCCAATATTCGCCACTATGCTGGATGCCAGCGCTTACCGCGTCTTTCCTGATGCTGAGAGCTACATCCAACGAATCTACG
CAGAGCAACAGCGCAAATACTGGGTAGCTGCCACCGATCTGTTTGTCGAAATGCAAAATAATTGCCCAAGTGAAGAGATTTCTCATCACCAGCTTCAGAA
GATAGCGTTAGGTAGGTACAGGATGCGCCAAAATGATCATTAAATGCCAAAGTCTCCTGTTTCACACCTGTATGCATCCGCCCAGCATCATTGCTACAAG
TGAACATGTACATACTCACATTTGGTTTTCAAGCAGGCTCTCCTCTTCATCGCGCAGCTCAGGAATCGAAGACGACAGAGACAAACCGTAGTTGGGGCTT
CCAGGAAAGCTGCTCGACGTAGTGCTGGCACTGCTGTAACCTTCTCCATTGCTGTTGCTGCTGGGTCGAGCGTAGATGGACTTGTCCGAGGCGGAGCAGT
GGAAGAAAGCCGCACCAAAGACGAGGACCAGTGCAGCGATGGCAAACACGAGGTCCCACGACCCCGTAGCTTGAAGGATAGCTCCAGTGACCACATTACC
GATAATGCCCGGAATGGTTCCGAAGGTGTTGGAGACTCCCATGACATGTGCAGCGTGGTTCGGTGCCACATCGATCATGTTGACCCAGTAGCCAGCCATG
GCAGCGCGACTGGTAAACAGTGTCATGCACAGCAAGGCCACCGCCATCGGCGCCGACTTCGCCAGACGCAGCGAAAAAAGGAAGAATGCGCATCCGAGGA
ATGAAAACGCGTTCATGGCCTGACGGACGTGCAACTCACGGTACCCGCGAGTGACCAACAGATCTCCCAGCCGCCCAAACAACAGCGTGCCGGTGTAGCC
ACACATATAGGGCAGCGCAGCAGCGAACCCACCCTTCTTGGCCAAATCAAGGTCCAGTACTTGGTTGAAGTACTGCGGGATCCAGCCCAACAGAATGTAC
CAACTGTAGTTGTAGCACATGTGTGCCACGTAGATGGCCCACGCAGGACGCGAAGTCAGCAGAACACGCCAGTTCATAGCGTGTGTGTCTAACTCAGCGC
GCGAGCTCTGGCGCCTGTGCGTGTCGGGGTCCACAGTGCGGCTGCGAATTATGAAACTGCGTTCTTCTGTAGTGATCTTCGGGTCCTCCTCGGGTCGACT
CACTCCCATGATCGAGTATACCACGACCCAAATGAAGCTCAGCGCACCAAACACAAGGAATATACGCTGCCACCCGCTCGCCGCCATGATGGCAGGCGAA
ATGAGCAGCGCAGAGATCGTGCCCAAGTCCGAACCACTTGCCACCAGCGACACGAGACGACTCCGCTCCTGCACCGGGTACCACGCGCCGGCAATTTGGT
GCATACAGGGAAATAGGATACCCTCTCCGAGCCCCATACCCGCTCTCGTAAAGAATAGGCACGTGAGGCATTTGGCCACGACCACCGTAGATACGTCCTG
CAATATTGACGCAAAAGAAACGATGTCATCAGAACTGTATCCCCTCCCATAGACCACCGATCTGTGTCGCCACGTACAAACAGCGTCCAGACAACAACTC
CGGTCAGCAGCACGACCTTGGCACCAAACCTGGTCGCAAAGTACCCTCCCGGAATCTACAGCAACAGCAGAATCTCTTTAGAAGCTGGGTTTTGTTGTTT
CAACCTTTCGTGCTGCCGTACTTGGGTGCACATGTAGCCGTAGAAGAAGGCGGAGAGCACTTCTCCCTGCTCCTTTTTGTTGGTGACGAATGCAGGCAGT
GCAATTCCCATGTTGGTTCCTGCGCATCAAATCAGAGTCAAACTTTGCAAGTGCAGCACGACTCACACACATAAGACGCACGTACGGTCGGCGTAGCAGA
TCGTGGAGACGCACAGGCACAGGAAGGCCGTCACATAGCGCCGCTTGCCCTTTGGCAGCTTCGCGGAGACGTCGCCCGCTGCAGTGGCGATGTCCGCCTT
CTTCCACGCCTCCTTGCTCGGCATCGCTCCAGATGTCAAATGAGCGGATCGCGACCGTTATGGGAGCACACTCATCAAGGGTTTCAGCCAATCACGGGCG
GGTAGACCACTTCAACTGCGTCAGTGGCACTGACTCAGTGCAGCCCTTCATGGCCTGGGTGGCATTTCAACGCATGGGATTGCTTGGACACATCAAGATA
AATTGACACACTCGCTTGGAGCGGATAAGCTTACAGGACTAACGTGAGGCCGTGGTCTACCCTAGCGGCGACTTGGCGCGGTACCGCTTCGGTGCCGCAA
GTGCTGACGTCTTGGCGGTCTTGCGTGGTGCTGTGCCTGTGCTGGGCACCTTCATGGTCCTATGCGGATGGGCCACTGCGGGCTTCTTGTGCAGTGCAGA
CGACCCTGTCCTCTTGATCTTGGACGGGGTGGTGCTGACTGCAGCGCTGGGCTTGATCTTGGACGGCGTGGTGTTAGCTGCAGCGCTGGGCTTGATTTTG
GATGGCGTGGTATTGACAGCAGCGGAAGGTTTGGTCTCGACTGGAGGTCCTGGGGTCTTCGCCGTTCTACAAGCATCAGCTGCTGACACCGGGTCAGGAT
TCTTTGATTCTTGACTGCTAGATAATGAGCTGCTAGCGGTAGCGGTAGCAGTCTCGGTAGTCTCGGCGCTCACGGGGGCATCACTTTCCGTTTGCTCGGG
GGTGTCTTCCGTCATATCGTCAACGGCAATGGGACTGGCATCGCTTAACCTCCTTCGCTTGTGTCCAGATAAACTCTCGGTTTCCATGAAGTTGGAGAAG
CTGGATGTATTCTCCACGGACTTCTCCGTATCGACGGGAACCTTGGTAGCCGGGAAAGTTGGAAAAGGCCGATTGTCCTTCTTCATCGGTGTCGCTCCCG
TCCGAGTATTGATCTGCAGACAATAAGCAACATGCAAACGCCAGTCAGTCGACAATTTATAATTTACAGGGCCGAAGAAATAAATGCAGCCATCTTACCC
GCCGTTTCTTCATGTACTCCTCCATCGCTTGCAATTGTTGGTTGGACGCCTCGGTGGCTGCACCGACAATCTCGTTACCAAGAGCAGATGCTGAATCAAC
CCTGCTTCTAGTGTGAGAAAGTTGGGTTTGAAGCCCCTTTTCCAACGTCTTGCATCCACCATTCAATAGCTGGCGGAGGTCCTCGTGATCGCTCAAGAAC
TGAGTCAACTGCTCCTGTTTCTTCGTAGATATCGCGATCTCTGCTTGTGAGTGATTCTCCATAAGCGTCGTCATACCCTGCGTGTGCGATTTAGCCAGCG
CAGTAACTTCGTTGCCCCAGGTCCTTTGCAGCTGCTCGTGTGATTGGATTAGATCTCTTTGCCGCACGTTCGCGTCACCAAGTTGGTCTCGCATTGCGGA
CAAGTCCTCGCGGAGCCCTGCCATATCGCTTTCGTGCTTCGAGTTCTGGTTGCCCATAGCCTGAACGTAGGCCTTCATTTCTTGTTCAGTGATGCTCTGG
ACGTGCGAGAGCTGCTTCTGCTGATTCATCGTGCTCCTTTCGATAAGCTTTGTTTGCTCTTCAAGCTTTCGTGACTGGTTGTGAATGCACTTCTCGACGT
ACTGAGCCAGATGTGCCTTCATACCATTCAGCTCCTCTTGTTGTTGAGCATTGTTGTCCTTCAGCGCTGCCGTCAGTGCCGCCTTGCTTTCGTCAAGCTC
CTTGATTTGTTTTTCGATCGACATATCGATTGCAACCTGCAATTCTAACAGCTTATCACTCTGCTCGATCAGAAAGCTGTTCAGCTCTTCGCGTGAACTC
TCCATCGCCGACTGCATGCTCTCCAGAAATGCCACGCTTTGAGATTTAGACGTAGCCAGATCTTCCATAATAGCTGCTGCGTGGTTCTTGGACATTTCAA
CCAGTTCCTCGAGCTGTTTTCCCATACGTTCCTGCTGTTTTTTCACTGTTGTGGTCACTTCGTCACGCTGGGCTCGCTTTTGGACATCATCTTCAGCGAA
TGATTCGCTAACCTGAGCTTTCCGCGCTTCAACAAGGCCTTGCAGTGCATTTAGGCTTGTTAATAGGCCATCCAAGTCCGCCGCATGAGCCGTCTGCAAC
TCATGCAAAGCATTTGATACATCTTGAAACACTCCTTCTTGATTTTCCTTGTGCTTCGCCAACCCCTGCAGGAACGACTGAATCTGCGACTGTGACTCAC
TTCGATACGAATTCGCTAGCGATGTGTTTGCATCATCTGCTCGCTGGGTGTTTTCTGAAATGACAGCAAACGCGTTAGCCGACAGCGAAGCCAGAAAGAG
AAAAAACAGTTACGTACCAATCTTTGCCACTAGCTGTGCCGCCCGCTTTTCGCTGTCAGTGTAGAGCTTCGCTGCAGCACTACCCTTATCGAGTAGCATC
TGCTCGTTTTCCTGATAGGCCTTCAGTGTTGCCTGTACTTGCTGCAACTTCTGCGTCGTCCTCTCCAGCGTCTCCTTTGTAGTAGCAAGTTCGCCTTCCG
TAGCAGTCAATTTGTTGCTCACCTCTTGCTTTGCATGTGTCAGGGCAGCGACCTCACTCGCATGCTTTTCAGCAGCTTCTTCAAGCTCTTTACAAGAAGC
GTTTCTTGCCTTGAGCATCTCTTCTAGCTCCGTCAGTTGGACACCCTGACCGCCCAATCTTTCTTGCATATCCGTAAACTGCTCCAGCGGAAGATAAACG
CCGTCTTTCAGTCTGGCAGCACGCAAAGCTGCCCGGAGGGTTTCAATTTCGCTTCCAAAGTCATTCAACAGCCCCGCCTTGGTCATCTTCTGGTTCAGTT
CGGGCTTATTCTTGATATGCTTGGCTCGGAACGCATATTCCAATGTACTCAGCGTCTCGTCAAGACTATCAGCGCATGGGGCCAACGTTGCAATAATCGT
CGTCTTTGCTCGACCACCAAGCGATTCCTGCAGCAAGCGCGTCAGCTTACTATCACGGTACGGTACGTGCGGAAGGTTGTCAACCAAAGCCGTGATCACG
CGTCCCAACGTAAGCAAACTCTGGTTAATAGTGCCAGCTTCTCTCGCTCTGGCATTGCGCGCTCCCGATCGGCCAACACACTCGGATCCAGCAAGATCCA
CCAGATTAAGCTGTCCGACACGCAGCAAATCTTCTCCCGGCGCGTTGTGCTCCTTGCTGTGGATTCGAATGGTGAAAATACTATGCGAACGACTCGAGTT
CTCGTTCATCAGCGTCTCGGACGTGATGCGGTTCTTCACGCCAGTATTCACGAGTTCGTACACGTGCTTGGCCGTGGTAGCCGTGACCTCGAGCAAGTTC
ATACAGTAGATCCCTCCTCGCTTGGCGTCCTCCATGAGCCGCAGCTTCTTGTCTGTGTCAGGGTCCAGCAGATCTTTGAGCTCTTCGTTGTAGAGCTGCA
GGAAGGACACGCGCACGCTGAACTCCTCTCCGCTGGCCTCCAGCGCGTCGAAGATGCAGCGGACGCTGCGTGGGATGACGCCCGCCGTCTCGCTGCTAGG
AGACAGGTCGCCCTGCATCGTGTACGTCTTGCCCGTGCCCGTCTGGCCGTAGGCGAACACGGTGCAGTTGTAGCCCGCCAGCGCCTCGTCCACCGCCGGA
CGCACCACGGACGTGAACACATCCTTCTGCGTCGAGTACTGGCCGAAGACGCGGTCGAACGTGTACGTCTTGCGCTTGACCACGGCCACCTCGCTCGAGT
GGGGCTTGCACTGCACGACGGCGCCGCGGCCCGCGGCCTTTTCGCGGCTGTTGAGCGGCCGGCAGCGCACCGCCACCTGCACGTTCGTGGGCGTGGGGGG
AGGCGGCGGCGCGTCGTGGTTGCTGGACACGGAGCACGACGACATGCGTCGGAGCTCGCTGCTGGCGTCCGTCGTCGTCATCCCTGGCCGTCGACTGCCG
CTGGGAGAGTGCGGGTTCCGTTTGAATTCGATTCAAAATCGCGCGCGAGAAGTCAGAGTGATGGTCGTGTACTCAATGACGCAAAATGGGTACAGGCGCT
GCCTCATTTGTGTGGTGTTACACCAATGAATAATTTTGGTGTGTCGACACACCATCTGACCTGCCGACCAACCAACGCTTTGAAGCGGCATTGCTCGACC
CCAGCGCATTGAGCAGTTGAGTGAGTGGCAACAAGATGGCGCAGCAGCCCAAGGTGAGCGAGACGCTGCTGGACGGACAGAAGCCCTTCGCCGAGTGCGA
GTTCGGCCTGGACCGCCGCCTCACCAAGGCGGTGGCCAAGATGCGCTTCGTGCACGCCACGCTGGTGCAGGTGCACTGCATCCCGCTGGCGCTGCAGGGC
AAGGACCTGCTGGTGCGCGCGCGCACGGGCTCCGGCAAGACGGCGGCCTTCGCGCTGCCGCTGCTGCACAAGATCCTGCAGCACAAGCAGGACGCGCCCG
CCAGCGAGCCGGTCGTGCGCGCGCTGGTGCTGGTGCCCACCAAGGAGCTGGTGGAGCAGACGCGCCGCCACATGATGGAGCTCATGTACTACTGCCAGGA
CACCGTGAGTCTGCTGGCCCTGGGCGGCCAGAGCATGAACGCCCAGCAGGCGCTGCTTCGTGACGCGCCCGACGTGCTGGTGTCCACGCCCGGCCGCCTC
GTGGCGCACCTGGAGGCTGGCAATTTGACGCTCAAGGACTCGGTGCAGACGGTCGTCATTGATGAAGCCGATCTGGTGCTGTCTTTCGGATACGGAGAGG
ACATCCGTACTATCTTCAATGCGCTACCGAAGGCCTGCCAGACGTTCTGCATGTCGGCGACGCTCAGCCCGGAGCTGGAGAAGCTCAAGCGCTCCGTGCT
GCACAACCCTGCCGTGGTGAAACTCGAGGAGGGAGCTACGGACGGAAAATTGCAGCAGTTCTACCTGCCCGTGAAGCCCGCCGACAAGGATCTGCTGCTG
TACGCGCTGCTGCGACTTGGTGTGGTGAGCGGCAAGGTCATCTTCTTCGTGAACTCGACGGACGCGGCGTACCGACTCAAGCTTTTCTTCGAACAGTTCG
TGATTAAGAGCGCCGTGCTTAACGCAAAGCTGCCGCACAACTCTCGTCAGCACATTATTGAGGAGTTCAACCGCGGCCTGTTTGACTACCTCATCGCTAC
GGACGACAGTGTGGACCGTGACGAAGTCGGCGACGAGGACGAAGATGAAGACGATGAGGACGGTGACGAGGAGGGAGACGAGGAGGAGGAGGAAGAGGAG
GAGGAGGAAGACGGTGAGAAGTCTGACGTCGAGTCCGAAGCTGTGGAGGAAGACGAGGAGAAGGACGACGGTAGCGACGACGACGAGGGCAGCGAGAAGG
AAGACGACGAAGCCATGGACAGTGATGAAGAGGCTCCTGAAAACGACGGTGACGATGATGACGAGGAGGATGACGAGGAGCAGAAGCAGGAAAAGAAGAC
AGTGGGCTCCAAGCGTGGTCGTGCTGACGAAGGCTACGGCGTGTCGCGCGGTGTTGATTTCCGCGGTGTGCAGTTTGTTATTAACGTGGACTTCCCGAAG
AGCGTGCGTGCCTACACCCACCGCATCGGACGTACTGCGCGTGGTGGCGCCTCTGGTACTGCGCTGTCGCTGGTGTCCAAGGATGACCCGAAGGAAGAGC
GTGCGCTGAAGCGCGTCCAGGCTAGGCAGCAGGCTGTCCGTTCCGAGTCGAATGATGTTATCGCGCAGCCCGCTGAGCTTGCGTTTGACCTCAAGGATAT
TGATTGCTTCCGATACCGCGTGGAAGACGTTCGTCGTGCTGTCACGCGTGTGGCAGTGCGCGAAGCACAACTGGCTGATGTCAAGAAGGAGATGCTCAAC
TCGGAGCGCCTGGCGGCACACTTCCAGGCTAACCCGCGCGATCTGAACATGCTTGAGCACGACAAGGTGGTGGGTTCGGCACCGGTCCAGCCCCATTTGG
CTACCATCCCGGACTACCTGGTTCCTATCGAGCTGCAGCCGCCGGCACCATCGCGTACCAAGAAGAAACACAACAAGCACAACAAGCGTCAGCGCCTCGC
CGACGGCAAGCGCCGTACGGACAACGACCCGCTGCACACGTTCGTGGCTCCTGATGCCAATGACGACAAGAAGCAGACTGTGGAGGATCGTATCAGCTAC
GGCAACTCGGGCGTGGGCAAGAGTACTGCTGGGCGTCAGAAATGGAAGAAGCAGCACCGCAAGGGCCACTTCAATCCCAAAACGATTGCCAAGAAGAAGT
ACAAGATGAGCAAGGGCGCAACTCATTAAATAGCTGGAGCTTGGAGCCATGCCTGTGGTGCTCGTCAAGGCTAGAGCATGGGCGCCAGGTATCACGGAGC
TTTGTTTTGCCAAATAGATTCACGTTTTTGCTTCATGTACGATGTTTCTTGCCAGTTTGGTTATTGAAGATTGCGGTCGACAGTTGAAGCGAAGGCTGGT
AGCGATATTGGTCGACTGGTGGCGAAGTAACGCAGAGCTGCCGGTGGCGAGTTGGTAGGAGGAACCAGCAAAGCAAGACTGTCGGAGTCTCCTTGTTCAT
GTAGCCGGACGATCTGCTGCCAGAGCTCGTCACCTGCTAGTTGTACCACACGGTCTGCCGGGAGCTCTTCATCTGGGACGTCCACTTCAACTAGAGCGGA
GTCAGCACGAGGCTGCAGCGCATCGGCCATCATCCTCTTCCGGTCGTACACATAGTCGAGGAGCTGTAGACTACGCATATGCTCAGCATGCTCCCGTTCG
ACACGAGCAAGGCGTCGGTGGTCTGCCTGGGTGCTGGCCGTGGCGCGCGCTGCCAGAATTTCGGGAGGAGCCGGGAATATCGTGCTCGTGGAGGATGACA
TTGCGAAAAGTGGCTTGTTGCGGCGCACCACCTCCTCTCGAAGCGCTCGGAAGTCGCGGGTTAAGAGAAGTTCTTCTTCTGCTAGAGCCTTCATGGCACA
TACTTCGCGAGCCCTCTGTGCTCGTGCGTCTTGATCAACAGCCCGACAATGTGCTTTGTGGAGTTGGTTCCAGTGGCGAATCTGATCGGTGCGAGCTATT
TGCATGTCAAGCTCATTGTCGCGGTGACCACGAACTTCTTCGTTGTGCACGTGTCGTGAGATCATTGCAACACTCGCAGTGAACGCACGCGCTATCTCAG
TGCTTTGCTGTCGGGCTTGTCGAACTCGCGCCTCGGCTTCCTTTTTCTTACGGTGTTGCTGGAGCTTGGCATTTTTGAGCTTAGTTACAGCGGCGAGAGT
AGCGGGGTCAGGTTTGCTGTGTGAACAATACTTCGCATGCAAGAGTGCTGGGGCAGAAGCAGAAGAGTTCAGGGAAGCAGCTCTTGGGGGTGGCTGGCGA
GCGTAAGATTCATACGAAAATGAGCTTGTAGCAGCGCTTTCGTGGGCAAGTCGATCAAATGGTGGCTGGGTGGCTTGTGCGGGTGACTGTTGCTCGTCGT
AATATAGTGGCGATAACTTTCGGCCCTTCCTTTTGCCTGCTTTCATTGCTTTCTGCTGTTTCTGCCAGGTTTTGAGATCTCGTACGTGCTCAATGAGGAA
TGTCTCGGTGAACCAGAGCTGGCACCCGTGAATGAAGTCACTCACGGAGACCGTAGGTCCTGCTATCGTCGACGGTTCAGAAGTACTTGAAGGCGGCAGA
CGTTGCTCCCATCGACGAAAAGCTGCATCGCTAACCTCCAAGCCATGAAAATGTAGCAAAGGTTTAATCTGCACAAGCTTCAGTCGTCGGGTTTGACGCA
CTTGCGGGTCAAACGTCACCATGAGTTTTTCGCACGCTGCCATAAAAATAACGCGGCGATGGCTGCTGCTTTGGTTTGTGCCGAATATTAGCTCAGTTGG
AGACAATGGTAACGTGGATGGTGGCAGTGCTGATAGCGAAGTGGATCCTGGGGCAGGGCTTTCGAACGTAACTGGACGTCGATCAAGCTGCTTGGCGTAT
GATTGTGGGCGTTGCAGCATGCGCTTCACTAGCTCGCGGTCGCGCACAATTTTCCCTATCGTTTTGATCGCTGCTGTCGAGTGCGGCTGGACGAGCGGTA
CGGCCTGACGATACAGCTCCAGCATGCTGTCGCCTTCTTCGCGGGACCTGGTCGAGGGATTTTCGAGGCTGATGTCGTTGTATCTGTCAGATGGATCGTC
CTCATTACTATCGGGCCGGGGTAGCTGGAAAGGCAGAAGACACTCCACTGCTGAGGGCGTCGACCCCGACAGGCTATGCATGACTGCGTTGTGCGGGCCA
CTAATGCACTGTTGCTCATTTAGATATGTAGCCATCTTCTGAAAATAGATGTTGCGCTGCGATTGGCTGGGAAGGTTGAAGTGGTGCTAGATGGATACAT
TTAGTGTGCTCACCGTCCGGTGGTTTTACATGCAGTCCATCTACGTGCGTTCGTGCTCAAAGTAGAGGGTGTAGCAGGTCCGCATCGTTCAGCATACTGT
GGCGAATACCGTAGCACAAGTACAAGACGACCCCTGCACCCAGCCAGATAAGCACACCGATCCTGCAACCATTAAGGTTAGCACAGTTTAGCTTCGCTGG
CCACGGCCAAACCTATAAAGAGTTCAGGATACGTACCAGCCCTCTCCAGGGATGCTTGCCACCATGTATACATTGGCTAGGATACCCGCACATGGCACCA
GCGGCACCAACGGGCACTGGAATGAGGTTGTCAGATCACTGTTCCAGTAACAAATACACAGCAAGTGATATCCTCGTGAGTTGAATTATCTTCATCAATT
CGCACAAACGATAGCAGTATCACGCACCTGAGTTTTCCGAGTCGGTAGATGTACACGAACGAAGCAATCACCATCACGACGAACACGCCTTGAATCGTCC
ACGGGAGATCAAAGACGAAGGACAGCGACAGAGCAAAACACGACGCCACGTACAGAAGGACGCGGTGGACAACACCAGCGCCACCGAGACTTGGACGCAT
GCGCAGGAGAAGAACACCAGCGTTCACAAAGGTGAAAACTTGCAACGTCCCACACGATATTACATTGGCCAGGAAATCAAGTTCAAACACCAACGCAATG
GACGCAACCAGGATGCCCGTGAAAATAGTGCTGGCCACGGGTACGTGGGTCCGGTGGTGCAGCTTGGCGAATATTGACGGCAGTAAACCATCCTTAGCCA
TTTGGTAGAAAATGCGCGGCTGACCCATCAAGCAGGTGAAGGCGGCAGTGGTGAGCCCGAAGATGGAGCCGAACGACACGATGCGTCCAGCCCACGGTAC
GCCATGGAACGTGAACGCATTCACAAGCGGAACCTCGTTACCGAGAACATCGACGGGTGCCATGCCAGTCACGACGAGCGAGACGCTCACGTAGATGGTC
ATCGAGATCAACAGCGAGCCGATGATACCCTTTGGCAGCGTGCGCTGGGGCTCGTGCACCTCCTCGGCAAGGCACGCCACCATGTCAAAGCCCAGGTACG
AGAAAAAGACCACACCAGCGCCTGTCATGATACCGTGAACTCCGGCAGGCATAAACGGCTCCCAGTACGTCGTATCCACCTCAGTGCTTCCAAATACAAC
CACGAACAGTAGCACCGAAATGTTCAGCAGCGTCACGAAAGCATTAAATCTGGCAGATTCCTATACATTGCACGACAAAACAATGGCAAACATTAGCATC
TCCACACAATAACAACGATTTTTTTGTCAGCAACATCATGGTCATACGTGAACGCCAGCGAGGAGGATGAAGGTGCAGCAAATGATGAGAAACGCTGCCA
GGATGCTACACGACATGCCAAGAAACTCTGCTTGCACGAGCCAACGCGGAAGATGAAGACCCACGTGTTGCAAGAACAAGTGCGCATACGACGCCCAACT
ACGCGCGATTCCAGCTGCAACCAATACAACGCACGATTAGCTCTCTTCAATACTGCAGCATCGCCATCGTCAACTCTCCGCTGTCGGTACCTGCCGAGAT
TCCGTAGCCCAGCGTCAGATTCCAGCCGATGAGCCACGCCGCCAATTCACCGAAAGTGATGTACACGAACGTGTAGGCCGAGCCCGTGACCTTCATCCAA
ACACACATTCAGTCTCACTGCTACCCCTCCCAAAGGCCACGACGCTACGTACAGGCACGCGAGCTGCGAACTCCGAGTACGTGAGCGACGTGAAGATGCA
GGCGACGCCGCTCACGAGGAACGACAGCGAGATGCTGGGCCCCGCGATCTGGGCACCCACGCCCACGAGCGAGTAGACGCCAGCGCCCACGGAGCAGCCC
ACGCCATAGGCGACCAGATCCGTGAGCGTCAGACACTGCTTCAAGGAGGTCGGACCAAGCTCGCAGCGCGACAAAGGCTTCACGCGGCCTGCCGCCTGGA
GGAAGCGATCCATGGCGAGGCTGGCGAAGCTGGAGAGAGAGAGAGAATGTGAGGAGATGGCAACCTGGCAGACGCTCACGCTGGACTCTGCGCTCTCGGC
TCAGCTGCGTGCCCCTTTAACGTAGGTATCAGGAGTTGTACAACCTTTTTTTCTTTTTAGCCAATTAGATATGTAATCGTGTGGGATTGGTTGAAAATCC
CCGTATCCAAAAAGGGGGCAGGCTAGAGCAGAAGAAGTCGAGCAAGGGGAGCGAGCGACGATGGCGTCCGTCCCGACCGAAGATGAGCGCACGCAGGTGC
TCAACGCGTACAAGGCCAAGGTCATGGAGCACCGCGAGATGGAGAGCAGGTGCGTATTGTGCTCTGCGCGTCGGAATTAGCGCATGTATCGTCTTGGATC
GCGCGTCAACGCGTCGCGATCTTTTGCTTCATCTTCACCGATTCCAGCGGCTTTACTGACGATAGCGTGCCTGTTTCCTGTGGATTCCAGGGTGAAGAAC
ATGCGCGAGAATGTCAAGACGCTCGTGAAGGAGTTCAACAAGACGGAAGACGACCTCAAGGCGCTGCAGGTGCGGAATTACGCCTCGAATTGCGTCTCTC
GACCTTTCTGGCTTGACTGACGATGCTGTTGTTGCGCAGAGCGTGGGCCAAATTATCGGCGAAGTGCTGCGTCAGCTGGACGAGGACCGCTTCATCGTCA
AGGCGTCGAGCGGCCCGCGCTACGTCGTGGGGTGCCGCGCCAAGGTGGACAAGAGCAAGCTCAAGTCTGGCACGCGAGTGGCGCTGGACATGACCACGCT
CACCATCATGCGCTACCTGCCGCGTGAGGTGGACCCCACAGTGTACCACATGCTGAACGAGGACGCCGGCAACGTGTCGTTCTCCAGCATCGGTGGTCTG
AACGAGCAGATCCGAGAGCTGCGCGAGGTCATCGAGCTGCCGCTGACCAACCCGGAGTTGTTCCTGCGCGTTGGCATCAAACCCCCTAAGGGCGTGCTAC
TGTACGGCCCGCCTGGTACCGGTAAGACGCTGCTGGCTCGTGCGCTGGCGTGCAACATTAACGCCACCTTCCTGAAGGTCGTGGCCAGTGCGATCGTGGA
CAAGTACATTGGTGAGAGTGCCCGTGTGATCCGTGAGATGTTCGGGTATGCTCGCGACCACCAGCCGTGCGTCATCTTCATGGATGAAATCGATGCCATC
GGTGGAAGTCGTTACTCGGAGGGCACGTCCGCTGATCGTGAAATTCAGCGTACGCTGATGGAGCTGCTGAACCAACTCGACGGTTTCGACGCACTGGGAC
AGGTGAAGATGGTCATGGCGACGAACCGACCGGATATCCTGGATCCGGCACTGCTGCGTCCTGGTCGTCTGGACCGTAAGATTGAGATTCCGCTGCCGAA
CGAGGCCTCGCGCATGGATATTCTCAAGATTCACTCGGGCCCTATCACGAAGAAGGGCGAGATCGACTACGAGTCCATTGTCAAGCTCACAGACGGCTTC
AACGGTGCCGATATGCGTAACGTGTGCACTGAAGCGGGTATGTTCGCTATCCGCGCTGACCGCGAGTACGTTGTGGAGGAGGACTTCATGAAGGCCGCGC
GGAAACTTGCCGAGACGAAGAAGCTCGAATCCAAGATGGACTACAGCAAGGTTTAAGTTGGTAAAGCTGTGGTCACTGTCATCTGGCGCTGGTGTACATT
TTTGTGCTACCTCGTTCAGAATGCTATCAAGAGTCGATACCAGTACGAATGGTCGACCTAGTCAAGCATATACGAGATCAAAATTGAAAATGAGCACCGC
TGGATGGTCTGTATCTTGATTGGGCTGACGTTGCTGTTGTTATTCCCTTGTTTGGCGCCGCAAATAACCCGTTTAAGCTCGGACGTAAATGGATGTCAGT
TTGCAACGGTGCGTGTTTGAGGCAGGCGAGTAGTGCATTGACATGGCGTCTTCAGGTGGAGCTGGCATGGAGTGCTGTGAGCTGGTGGGTCTCATGGGAG
ACGTTGCGTATCAGCGTTGTCGAATGCTGCTCCAAGAACTACGAAAGCTGCACCCGATCTTCGTATCGCCGCTGGAAGGGATGATGGAGATCGAGTATCT
CGAGTATTTGCAAAACCAACAGGAGAAGATCCCCAAAGCCAAGCGTGCTGAGTTGCTGCGTACGACCCGTCCGATTATACTGCTGCTGGATTCCTCAAAT
GACATGCTGGACGGTGAAGACGAGTTGCTCGACTTTGCGATGGAGCGGACTCAACTCTCCAGAAACGAATTGTTGGCCGCAGCCGCGTTCGGGGGCGTTC
TTGCGGTTGGGAACGACAGTGAAGGCTCCGACAGCGCTCGGAAAGAGTACAGCGAGAAATTGGCACTCGCAGAGGAAACACTCGAGACAAAGGCAGAGGA
AGCGGCACAGCAAGCTTTGGCTCGGCATCGCGAACAGTCCGGGCATCAGTTCGCTTTCTTGGTCTTTGAAGTGGATGGGGTGGCGCTGCCTCGAGTAGAG
CTCGAGTTGTTCCACGACGTGTGCCCCAAAACGTGCAAGAATTTCCTAGCGTTCTGTGAGCACAAGGTTCCCGCTATTGGCGATGAAACACAGCAATTAG
GCTATAGAGGCAACGCCGTCCATCGCATTGTGCGTGGTGGTTGGATTCAAGCAGGAGATGTCGGCGGCAATGGCCGAGGGGACGGACCTTGTCGGTCCCT
CTACGGTCTCGAGTTTGCCGACGAGAGCTTCGCCATATCACACAACGCGGCTGGCATTCTTGTACGTTTTTGCTGTCTATTGTATCTGCAAGTTTTGACG
CCTCTCATGACGACTTTGATGGTCTTGGCATTCAGTCCATGGCGAATACAGGACCACACACGAACGGATCCCAATTCTTCATCACCCTGGCACCCCAGCC
ATGGCTTGACCGCCGCAAAGGTACAACAATAGTAGCAATGTCTTGGTAACATATGTTGCGAACTCACGTGTGTATGCATGGATATGACCTTCAGTTGCAT
TTGGACGAGTCGTGAGTGGTTGGCGTACTATCATGACCATCGGCGGCTTGGAAACGAGTCACGAGCGACCTTGCGTGCCCTGCACTATTGCCGATAGCGG
AAAGCTTCAGTGAGGCAGCG