Description :
From Genome Similarity Track
Location :
contig_96:9145- 10481
Transcript NameFunction/comments
g10852.t1hypothetical protein PHYSODRAFT_506240

Sequence
1336 bases(100 bases per row)
TTGAATCTCCGCACTCGTCTTGCCCGACGTCTCCGGCACCAAACTGAGTGCCATGCAGTAAAAGACCGCCAGCAGCGCCACGAACGGCAAATAGCTCAAG
TCCTGCAGCGCGTCGGCCAGGTACGGGTACGACACCCCCACTACGAGGTTGCAAAGCCAGTTGATGCCGATACAGAGCGAAGACGCGTGCGCGCGAATCG
CGTCTGGGAACATGTCGGCAGTCATCACCCACACGAGCGGACCCAGCGTCACGCCAAAGATGACCACGTACAAGGCCGTGAAGAGTACCGAGAGCGCAGC
CACGTCCACGAGAAACGCCACCGTCATACCAACGGCCATGAGCAACATGCCTGCTAGTCCCCACAGGATCATGACGCGATTCCCAAATCGAACAGCTAAA
CAGCCCGTGAAGAATGCCGGCCAAATGTTGATAAAGTCGATGATAAGTGTGCCAACGCGAGGATCCGAGATGCCAGCATCCGCGAAAATACTACTCGAGT
AGTAGAACACAGCATTGATACCCGAGAGTTGCTGCGAGCACGACAGCAAGATGGCTCCAGCTAACTGTCGGCGATACTTTGGGTCGAGCAGCGATTCCTC
CACTTGCTTCGCGGTGATCAGGCCTTCCTCGTTGTCCTTGGGCGGTTCGAGCCACGCCAGCACGGAATCAACGTTTCCCTCGCCATAGAGTCGAGCGATC
ACGCGCTCAGCTTCTGCGCGCCGGTTCTTCATCAACAGCCAAGCAGGACTCTCTACACAAAGTGACGGAGCCAGCCCCAGAAACAACCCCGCCAGTACCA
GCGGGAATCCAGCCAGGAACCGCCAGCCGGAGCTTGAGTTGGCGAAGAAGAAGGCAACGGCCGGCATCATGATGCCGAACGTCACGGAAATTTGCAGCCC
CAGGCCCAAGACGTTGCGCAAGTGCGGAGGCGACAGCTCGCTCACATAGGCGCCGATTGTCCCCGTGGCGACACCCGAAGCGATGCCCGAGATGAGTCGG
CCCGCTGCAAACGGCCAAATGGTCGAGACGCTCATTTGGACCACAGCCCCGACCGCGATGAAGCCGCAGTTGGCAATCAGCAGCTTCTTGCGGCCCCACA
AATCGCTGCATCCCCCGCAAAGCAAACTCCCGAGCATGGCGCCGAAGATCCACGCGTTCACGGCGAAAGTCCATGCCAGCTTCGAGTGGCCGGGGAACAT
GAGGCACGTGCCGTCCGCAACGGGGCGAGCTTCGCACTCGGTGGCGTCGTTGAACTGGGCCAGATTGAGCTGCGACGTGGACCAGCCGCTCTGGAAAGGT
TGGAGCAGGGACACGAGAACGCTCAAGTAGACGGCG