Description :
From Genome Similarity Track
Location :
Scaffold_210:91405- 98345
Transcript NameFunction/comments
Hyaar_Emoy2812642hypothetical protein

Sequence
6940 bases(100 bases per row)
AAACGTTTTTCAAACTAAACATGTATCGTTGGTTGGTGTGGTCGGTCGCTGGCTTCATCGTGTCCTATACCGCTCTTACGGTCGAGGCCATTTTCAGTCG
GCTAAGTGTAATTGAGTAGGACGTCGAGTGGTAGTGGATGCAGCTTGCGAGAAAATATTTATTATGCTAGTTAGAGTAAAAAATTGTGTAAGCTAAGCTG
AGTCGAGGACAAATACACCGGCCATGACCACGGCACTGCAGGTAGCCCTCCCCCCACAACAATAGTCCACGGGGCGCAAGACAGCGAAACGACGACGCAG
ACCGCAGAGCAGAGATGAATCCAAAACGTAATTGGCGAGGACGAAGAGCAAAAATCCCGCGTGTATAGCTGGAGAAAAGAAGAAAATAGGAAGTAGTGAA
GGTAATGGGATTAGACCAAAATCTTAGGTCATGAAATCCAAAAATAAAGCTTCCTCACAACCACGGTAGTGTTCGGTAAGAAGAGACGTCGTAGGGCCTA
AGAAGTGAACCATAAGAGATTAAACGAAATTCATCGAAGCTAAGTACGCTTTCCAGGAAGCTATAACTACACTGTAGGAAGTATCTTCAGAAATCAGTAG
TGCCACACCGGTCGTATTAATGAAGCTAATGTTGGGCGAGTCCGACCAAATCGTCAAAATAGTTTCAATACCGGAAAATACACCAGAGCAGTGATCGTAG
GTGGAAAATCCCCCAAGCACATTGCAAGAACCCAAGTGCGGAATCCAGGTTGCCGTATAAACAATGTAAAAAAACGCCAGCAATTCGTATTGCCGCACCG
GAAGTGGTGATGTAGCTAATATCGTGCGAGATCAACCAAATCATCCAAACATTTTAGTATCAAAGATACCCCAGTGCAGTGGTGGTCGGTGGAAAATCCC
TCATGCACTGTAAACTAACCCAAGTGTGCATTCCATGCCGCCGTAGATACGTCAGCAAGTACCTTCAGCGATCCGTACGGCCGCACTGGCCATAGTGATA
AGGCTCATTTCGAGCGAGGTCGACGAATTCAATAAAAGTTATTGTATGGGAAAATATACCAGAGCAGTCGTAGTTGGAGTTAATCCCCCAAGCATCTCTA
GAGAACTCAAGTGAGCATTCCTGGTAGCAGTCGAACACTATAGGAAGCAAAACCAGCAATCCGTAGTGACACACTGGCCGTTGTAATGGATCTGGACGCA
GCTTGTAGCCTGGCCAGTGCTGAACTTCGTTGTGTCAGCTGCTATGACTTTTATTTGGCCGCAGACACAGAACAGCTCGCATTTTGCGTACTCTATTCAC
GCATGTGCAAATGCCGAATTTTTATCAGTCCTTTTCATCTCTTTATAAACTGCTTAGTTGTGTAATGTTGTACCCCATTTACCGATGACGGATAGTCCAG
GTCTCGAGATACCACACATGGCTCGTCGCTTGAGGATGACATCTATCTGAGATTTATTCAGACTCGGATGAAGAGTTCTTTCGTAGTCCACTTACTGAGA
AGAAGAAAATCGACAACGGCAACGATTTCGACGACGTGGAAGGGGCCTATCTAATTGCACTTGTCTTTGCGATTCTGGCGTACCCACGCCTTGCGCTCTC
TTCGGGGAGAATTTATCGCTGATGATGGTCTTTCTCCATCGGGCGTTGCTTTGACATCACGTACATCCGGTTGATTGACTGCACTTGTGGTCTTCATTAC
ACCTATGAGTTAAAATTAACGTAGCCTACCCACACTTTTGATTCACAGGATAGCAAGTGATGACAGCATAGGTTTGCACCGAATTGGTTAAAGTGGGTAT
GACATCAACGTGTAAATATAAGATCTTGATAATACAACACACATAATATATGCTGCTCACCCTGTAGCTGATATTAAGTGCTCTAACAAACCAATGCTCA
TGAATCGTCTCTTGTGAAAAGCTTTAAAAGAGGTTGTCAGAGAGCCATTTGAACAAGAATTAATGTGTAGTTGAAGGAAGTTTAATTTCGTGAGATGTCA
TCTAAAATGTATGTAGTTAAAGACTATCTTCTCCTACATCAACACTCCAATGTTTGACACAGCACTGACAGCATCAAGTACATAATCTAAATGCGCGATA
TCCTCGATCTGTCGCAACGCTAGGGGTGCTGCAGGAGATGCTTGTGCTTGTTCCACTTGATGACATGTTCTTGCGTTGTGTCCTGAATGTTCACAGCGTC
CGCATCGTCAACGTCGCGTACGATTAGATCCATTCTCTAAATGCTCAAATTTAGAAAAAAAATTGCGGCGGGTAGAACCTCTCGGGCACCCGCGCGTCCT
TACCATCACAGGACCACGTATTGCGGAACCTGGGGCAGCAATAGCACGATCGTATAGCATCCTTTGCTGAGGTCTGTCAGCAAGCACATACCTCTCACGA
AGTCCTTTTAACACGTCATCCTAATTGACAACATCACCTCCGCCTGGCTCGGTGTCAGTCCTTCGTGTCGAAGGTTATACTAGCTACCAATGCTGGTCTA
AAGCTTGTACTATCAACGCCCATTGCAATCCAATAATTGCATGACGACAAGAATGGCCATGTTCTTTATCACCAGATTCTGACAAGGTCCTGGTTCAAGT
CTCTTAATCCTTTGACGATGGGCTGCCAGTAAACCTGCAGCGGAAATCTTGCCCATTACTCCTGCAAACAGAGGTCCTGGATGCATTTAGATGATGTCGC
TTTCTCTTGCGTTTTGATGGCTAACAACAGCGAGTTGGCCGTGGCAATCCAAGTCGAGAGCCGTTCTTATTGACCACAGTTCACCTAAGGACAAGAATAA
TAATTAAGTAGTCGAACTACCAATATCGTCAGGGACAAATAATTCTACTTACCTGTGGAACCATTCAACCACTACTTGAGAGCCGCATGCGCGCTTCGAC
ACGTGACGTTGTCGCATAACCAAGATGTAGAAACTAAACAGGTATCAAGTCACGAACAATTTCTTGTAAACCAGCCAAATATCCTCGATATAACGCATTA
CATGAGCTGGTAGATCAACCCTCATCGCAATAATCTGGCGGTCATACTCTGTCGTTGTTTGATCTTGTACTAGGAAGTTCCGTGTTCGTATTAATGTTAA
AACTCCTCCGCGGAGTCGAAGTGTCTTCGCATCTTGGTAATGATGTTCCTGTTTATGTGACATCACCAAAGGAGTGTACTCTCAAAGGGGGAAGACATCT
ACCGGGCGCATTCACTAATGCCATCTCGCGATCAAAAACGAATGTTTTAGGTGTAGCGATGTCGAACATCCCAAATACCCGCCTCAGGTTCTGCACCGCC
CACAGGTAGTCGTCCTCTGCCTCAGGGCGCATAAAGAAATAGACACAGTGTAGCTGTTGTTGGTCGCAGTGACGCCTACAATGTGCAGTAGAGGTAGTCG
AAATCGATTGGTCTTAAAAGTGGCATCAATCAAAAATACCCGAGTTGCACTGAATCGGGCGGTGATTTTCGTGCCAGAGATAAATACAACAAATAAGTGT
GTGGGCTGCTGCTCAGCATCAAATTTCGCGTAGTACGGCGCATATTTGTTTTTGTTTGTTGCTAGACTGTCAAGGGAGTGTGTTAGCGGGAGCTTTCCTC
CTGACCATATGCAGCGCTCATTTGCGCGAATATTGTACATATCGCGCGCAATGACACCCACAATACCAAGTTGCCAAATGGAGGCAACGATGCGACCAGC
TCTGACACCTGCACGCAGATTCGCAATCACTAGTTGTTCTTGGCCTTCCAAAATGCCTGCCTATCCACGCGAATGCACCTTGCTATTTTTAAAAAAAATC
ATGGTTATGCTCTACATGGGCGACTTTATTTACCACTGGTCTGGTTGTTCTTGACGTCGCTGTCGTGTGATCGTGGCCTAAATGAAGCAGTCAGTGGCGC
GGCTGGATCCCATACGCTGACGAAGAGGTGCTATACCTGAATCGGCATCAGAATAAGGTCTGCGGCAGTTACATGAGTATTGCAGATTCACTGCGTTATC
TTCACCTTCCTTGCGGTTACACACCCTTTGTCGCCATTTAAGTGCTGTACCATAGCTTTCCGGCAGTTTTAGCTCCTCGAGCACATGGCGGGCTTCGTCC
ACAGAACCAAACAGCTCTTCTGTGAGCTCGTTAATACCTTTCATGTTGCTTTGAAGGAAGGAGGTCAGAAGTACGATATAGTAAGTGATATGAGATCAAT
GGACGTTGTTTCTATAACGTACAGCAAAACAATTTGACAATTTAGGCGGTATCAAATTCAATTACTTGTTTAATGTATGGTGTGAAGGCTCATTACCGGC
TTCCTTTTTATATTATATATATTTAGCAAATTTATAAAAAATCATTCCATGAAATGGATATAGAACGGACGCTACCAGAAACTGCATCTTCGGTCACCTC
CGCCGACAATGTCACTCAGCAAACAGAGGGTGCTGCAAGTTATAATGGCAGAAAAGATAGGCTGGTTTTGGACGTACTGTATAAGGCTCAGAGAAGAATG
TAAAGCGGTTTATCTGGTACCAAAGCTTCTTGGTGAATCAGAATTTGCAGAATACGTATGTATGTACAGCTACGAGTGGTTCCAAACATTGTTGCCGAGC
ATTTGATGAACAAGCATTAGATGCACGATAATATACCTGAAAAAGGGTGCAATGTGTGCATATTTAAAACTAGGCGATATGAAGGTGTGTGCATCGCGTA
CGGTAATGTGATTGAATTTAATATGGTATTAGCATGATAACATATAACATAAACCTTATCTAAACAGGCAGACATTGAAGAAGGCATTATTCAAACTTGT
TCTAGATCATTCGCTGCCTTATCAGTTTGTGTAATATAGGCAACTGCGTGATCTTCTCAAGCTTTTCAGTCCTGCAACAAGCTCTTTGTTGACATCCGCA
GATACGATCACACATGATGTTCTGGTGATGTTTTACCAGTGTACATGTACGCTCTAATTTCGCGGCCAAATACATTTGCTAACGTCGCTATTTGCGGGAT
GTAAAAAGATGAAAATGACTTTAAATAACCTAAACACCAAACTGCATTTTACTTTTCATTGCTGGACTTCTCGAAAGCTTCGATTTATAATGGGAGTGAC
CGCTCATTGCATTAGAGACAAATGGAAGCTCTACAATCTGGTTGTTGCTGTATTGAAGATAGAAGGAGATCACAGCAAACAGAACCTTGAGCAGCAGCTG
CTCAATGTGTTGGAGGAGTTTAACCGTTTACTCAAGGTCTTTCGTATCTCCAGCGAAAATGCTTTAACGAACGGCACAATTGCAACGTGCCTCGAGCAAC
GGTGTATCATTCCCGGATTCAGCGACAACATGCTTAATTTTATGGCTCATGTGAGAAATCTGATAGCTAATACTGGTATCGAGCTACTTGTAACATTTGA
TCACCACTTGAATCAGATTATTCAAAAAAGTATCATCTTAATGTCCACAGATAATATACTTGTAGACCAAGATAGAGAAACTGAAAAAGGTTACATTTTT
ATGAATGTATGGGCTCATTTTGTATATAATATGTCAAATTTTTATATTGTTTCAAGCAGAGGATACAGTCGTATGTAGAGTTCGTGACTTTGCAACACAT
CAACGGTTCGCCGCAGCGACTTCAAAAACTTAAAATGCTTCCGGATTTGGTCGCATCAGATATCAGAGCCAAGAAGACGGTGCAAGATGTAGCCACAAGG
AAAAAATTCTACTTTGGAAATGTTGAAGCGTGCATTTGCGCTTCCAAAGTCATTGAATCTTATGTATACAGTGACGTCAAGCTTCAGAGATATGTGCTTA
TGGAACATGAATCGGCTCTTGTGCAAGAAGTCATCAAGCTGCTTGAACCATTGGAAGAGGTAGTTGAAGAATTTAATGGACATTTATTAATTGTGACATG
TAAATATAATCTTGTTTTTGGCTACGGTGCTTTTGTCATCTTTAAAGTATCAAACCAGTTACTGCAGCAGCACCTGTATATGCCATGCTGTTGGAGAGTA
TTCAAGAAGCTCTTCGCTCATATGAAGGTGCATTACTCGAATCATCAATTAAGCCATGGTGAAGAAATTGAGAGCGCACAAGGAGAGAGCCGATGGTCAA
CCATTTTACAAGATTGTAACAGTGTTGGATACTCGAATAAGGATAAATTTCTTCAGCGCCATAACCCTGGACACTGGGAATAAACGTAATCTGCTTTTCA
AGAGAGCTCAGCTTAAAAAAGCACTAAGATCATTCGAGTCCCGGTGTGGGAACATCTTTGCTCGCATGATACCGCTCATCTTTCCTGACTGCGGTCTTGA
TGAAATAGAAGTACGACTTCCCGCAACTTGATTCTGTGACCACTTCGTACTGGGAAGCTGTGTTCATCAGCATCTTCGTCGATACATCATGCGATGATAG
TGTAACACTCAAGCTAGCATGCGACTTCTGCGATGGACAAACCGAGTGCAATATGGGTGTGGTGTTCCGCATCGTAAGTACGCTGTCATACACTGAAGCC
ATATGGCAGCTTTCATCGTGTTTGCGTCCAAAGTAGCGTTTATATGTACACGAAATACCAATGCGAATGTGAGCTGAAAATGAGTATGGTGGATTCAAGC
ATCCACGATTTGTTTGTATCGTGCATTGATCAGCAGCATTGTGCGATCAATACGGTGATGTGTTTGAGTGCTCTTCTGTTTGTATGGTGTGTTTGAACGT
GTTGGTGTGTCAACTGGTCAGCTTTCCCATATAGTCTAGGCGGTTAGGATAGCTGGCTCTCACCCAGCAGACCCGGGTTCGAGTCCCGGTGTGGGAACAT
CTTTACTCGCATGATACCGCTCATCTTTCCTGACTGCGGTCTTGATGAAATAGAAGTACGACTCCCCGCAACTTGATTCTGTGACCACTTCGTACTGGGA
AGCTGTGTTCATCAGCATCTTCGTCGATACATCATGCGAT