Description :
From Genome Similarity Track
Location :
Scaffold_55:91401- 93846
Transcript NameFunction/comments
Phyta_totarag2408hypothetical protein PHYSODRAFT_466148
Phyta_totarag2409hypothetical protein

Sequence
2445 bases(100 bases per row)
TCCTCCACATCTCCCTCtcatctcctccatctctAGCCCTTTGATCGTCCTCTGCAAgtctctccttctcgcgctcaACAACTCTCTCGATCTGTCATCt
gtcaccaccttctcggCCTCCCAGAAGCCCCTCTCGGCCTCCTTATAAAGGCCAATAGCCGTCTCTCTGTCTCTGCTCTGCTGTGCTCTCTCCAAAGCTG
CAAAGGCGCCGTCCAGCAGCCTCTTCCCAGGCTCAAcatcctcctcctgctcttctcctctcaggcagcgcagcagccgctcgcGCGTGTgcgccacgtc
cacgaaAACCTCGAGGACTTgagttcgagctgctgtttggtACAATTGGGCGCGTCTCACGTCGTCCATTAGCCTCACcgtcaagtgcagcagcttcttg
gtctcctttGGGTCTCCGCTGCGCTTGCAAGCGTCTGCCGGACTGGAATTGAGCACCAAATACTCAATTTGACCCAATTGTAGCACGAGTTGGGGCTGGT
TCCAGAAGGGAAGAACTTCGCTACGCACGGATATGCGCTTCTGGCTGTAGCAGGGCGAGTAGAAGGTCGTCTTGGGCTCCAGTAGCAGCCACGCACTGCC
CAGGAAGCGCAAGTCTGGCGACAACATGATGACAACTGAGGAAAAGAGAAAAAATTATTCAAAACCTGATTGCTGACGTTATCGGATGTTGGCGGTATTA
ATTACCGGTACCAACAACGACGGATAAAACCGGCAACGCAAAAGCCGGCATTTACAGAGTCAGGACTTGTGCTGCCCATAGTAAAATCGATCtgattttg
tccaatcagATTTTATTTATAGAATAAATGGCCCAATCGCTACACATAATTTATTGAATGGCTCGCGCAAAACCACGCCAACCAGCGCCTAATTCTCCTT
CGCAAATTGGCGCGAATGTCACTTTCCAGTTCGCGCCAGGATGGCCAGGCCCAAGCAGAGGAGCTACACCGTGCGCACAAAGCGCGACGCTGTACGCCGG
ATCAAAAAAAATCGGGGTGGAAGAGGTGGCTCGTGAGCTGCTGTGCGCTCGAGGCACAGTCCACGGCTGGTGGAAGCAAgctgacaagctgctgagcttc
acCGGCCACGCCACCTCCAAGACGCTCGAGGGGCAGGGATGCAGGAGCTGTTTCCGAACGTCCCTGCCGTCGTCACGTACATGAAGGACACGCGTCGCGA
CGAAAAGGTATGCTGCATCTGTTAAAAGGTCGGGTTTCAAGCTAAAACTCACGTTTTCACTATTAATTTGTATTTTTAGGCGCTGACTACTCGAGGGATG
ATGGAGTACATGTGGCAGCTTGAGACCGACTGGGTCGAGAACTACATGGAAGGCAAGAAGAGCGGTCTGCTTGCACTTCAGCGCCTGTACGAGCGCATCG
CTAATCGGCAATTTTTCTATACGTGTGATAAATGATATGAAATCGTGTTAATTATGTTTTTATTGTGTTTTTATTGTGTTTAGGCATGGTTATTATCCCC
AAAAGCCACGAGCTGCGAAAAAGAGCACCACCGACCTCGAGCAGACCTAGGCTGAGTTTGCGCTCGACTTTTGGACGACGTATGCCGCGTACGGACCGAC
TGGCATGTACTATGTTGGTGAGACCGCCATCAACTTTGACATGCCGTCGTCGCGTATTTGGGCGTTCAAGGGGCGCCGCGATCCGGCGCGCATCGTGAAC
ACTTCCAAACATGCTGGGCGGATGACAGCAGTGATGACAATCCGTGCTGGCGGTAATTTTTCCTTTCTTATTGTGTTTTTGTATTTATTGGCTGACTAAC
TCATATTTTTGTTGTAGTTTTCAGGTAAAAAGCTGCCAATACTGTTCATTGTGCGTGGCAAGCGCGGAGGTCGTATTGAGGCCAGCGAGTTCAGTGACTA
TCCGGAAGGGCACTTCTACGCGATCCAGGAGAGTGCCTGGATGGATGCTGTAGGCTGGAAGTTTTACGTagagaagctgctgaagtacGAAATAGATGGA
CCCGCTGTCCTCTTGCTCGATAACTTCGAGTGTCATGTGTCGGATGAAGGGCAGCGGGtcgttgctgaagttgccaACGCTACAGTTGTCCCATTACCGG
CCAACAGTACGGCAGTTTGCCAGCCGCTGGATGTTGGGGTGATGGGACTATTGAAGGCCAAACTTCGGACCAATTGGTCCGGAATCACCGGGGGCACtgc
caagcagaagcgcatcCGGGCGATTCAGGCGACAATTGCGGCATGGGATGATATCTCAGAGACGACGGAAATCCGTAGCTTCGAGAAAGCTATTCCGCAG
TACCTCGAGATGACTGTTTGAATAAAAACATCGCATTTGCATGTATTTTGCAATGTATACGATTTTGTTTACTGTTTTATGCAGCAATTATTTTTTGCAG
CCAATACTAACCTTGTGCCGGCTTTTGTGTCAGACTGCTTCACTA