Description :
From Genome Similarity Track
Location :
contig_96:9140- 10476
Transcript NameFunction/comments
g13289.t1POM76639.1 LOW QUALITY PROTEIN: Hypothetical protein PHPALM_6098 [Phytophthora palmivora var. palmivora

Sequence
1336 bases(100 bases per row)
TTGAATCTCCGCACTCGTCTTGCCCGACGTCTCCGGCACCAAACTGAGTGCCATGCAGTAAAAGACCGCCAGCAGCGCCACGAACGGCAAATAGCTCAAG
TCCTGCAGCGCGTCGGCCAGGTACGGGTACGACACCCCCACTACGAGGTTGCAAAGCCAGTTGATGCCGATACAGAGCGAAGACGCGTGCGCGCGAATCG
CGTCTGGGAACATGTCGGCAGTCATCACCCACACGAGCGGACCCAGCGTCACGCCAAAGATGACCACGTACAAGGCCGTGAAGAGTACCGAGAGCGCAGC
CACGTCCACGAGAAACGCCACCGTCATACCAACGGCCATGAGCAACATGCCTGCTAGTCCCCACAGGATCATGACGCGATTCCCAAATCGAACAGCTAAA
CAGCCCGTGAAGAATGCCGGCCAAATGTTGATAAAGTCGATGATAAGTGTGCCAACGCGAGGATCCGAGATGCCAGCATCCGCGAAAATACTACTCGAGT
AGTAGAACACAGCATTGATACCCGAGAGTTGCTGCGAGCACGACAGCAAGATGGCTCCAGCTAACTGTCGGCGATACTTTGGGTCGAGCAGCGATTCCTC
CACTTGCTTCGCGGTGATCAGGCCTTCCTCGTTGTCCTTGGGCGGTTCGAGCCACGCCAGCACGGAATCAACGTTTCCCTCGCCATAGAGTCGAGCGATC
ACGCGCTCAGCTTCTGCGCGCCGGTTCTTCATCAACAGCCAAGCAGGACTCTCTACACAAAGTGACGGAGCCAGCCCCAGAAACAACCCCGCCAGTACCA
GCGGGAATCCAGCCAGGAACCGCCAGCCGGAGCTTGAGTTGGCGAAGAAGAAGGCAACGGCCGGCATCATGATGCCGAACGTCACGGAAATTTGCAGCCC
CAGGCCCAAGACGTTGCGCAAGTGCGGAGGCGACAGCTCGCTCACATAGGCGCCGATTGTCCCCGTGGCGACACCCGAAGCGATGCCCGAGATGAGTCGG
CCCGCTGCAAACGGCCAAATGGTCGAGACGCTCATTTGGACCACAGCCCCGACCGCGATGAAGCCGCAGTTGGCAATCAGCAGCTTCTTGCGGCCCCACA
AATCGCTGCATCCCCCGCAAAGCAAACTCCCGAGCATGGCGCCGAAGATCCACGCGTTCACGGCGAAAGTCCATGCCAGCTTCGAGTGGCCGGGGAACAT
GAGGCACGTGCCGTCCGCAACGGGGCGAGCTTCGCACTCGGTGGCGTCGTTGAACTGGGCCAGATTGAGCTGCGACGTGGACCAGCCGCTCTGGAAAGGT
TGGAGCAGGGACACGAGAACGCTCAAGTAGACGGCG