Description :
From Genome Similarity Track
Location :
contig_96:9140- 10476
Transcript NameFunction/comments
g12768.t1hypothetical protein

Sequence
1336 bases(100 bases per row)
TTGAATCTCCGCACTCGTCTTGCCCGACGTCTCCGGCACCAAACTGAGTGCCATGCAGTAAAAGACCGCCAGCAGCGCCACGAACGGCAAATAGCTCAAG
TCCTGCAGCGCGTCGGCCAGGTACGGGTACGACACCCCCACTACGAGGTTGCAAAGCCAGTTGATGCCGATACAGAGCGAAGACGCGTGCGCGCGAATCG
CGTCTGGGAACATGTCAGCAGTCATCACCCACACGAGCGGACCCAGCGTCACGCCAAAGATGACCACGTACAAGGCCGTGAAGAGTACCGAGAGCGCAGC
CACATCCACGAGAAACGCCACCGTCATACCAACGGCCATGAGCAACATGCCTGCTAGTCCCCACAGGATCATGACGCGATTCCCAAATCGAACAGCTAAA
CAGCCCGTGAAGAATGCCGGCCAAATGTTGATAAAGTCGATGATAAGTGTGCCAACGCGAGGATCCGAGATGCCAGCATCCGCGAAAATACTACTCGAGT
AGTAGAACACAGCATTGATACCCGAGAGTTGCTGCGAGCACGACAGCAAGATGGCTCCAGCTAACTGTCGGCGATACTTTGGGTCGAGCAGCGATTCCTC
CACTTGCTTCGCGGTGATCAGGCCTTCCTCGTTGTCCTTGGGCGGTTCGAGCCACGCCAGCACGGAATCAACGTTTCCCTCGCCATAGAGTCGAGCGATC
ACGCGCTCAGCTTCTGCGCGCCGGTTCTTCATCAACAGCCAAGCAGGACTCTCTACACAAAGTGACGGAGCCAGCCCCAGAAACAACCCCGCCAGTACCA
GCGGGAATCCAGCCAGGAACCGCCAGCCGGAGCTTGAGTTGGCGAAGAAGAAGGCAACGGCCGGCATCATGATGCCGAACGTCACGGAAATTTGCAGCCC
CAGGCCCAAGACGTTGCGCAAGTGCGGAGGCGACAGCTCGCTCACATAGGCGCCGATTGTCCCCGTGGCGACACCCGAAGCGATGCCCGAGATGAGTCGG
CCCGCTGCAAACGGCCAAATGGTCGAGACGCTCATTTGGACCACAGCCCCGACCGCGATGAAGCCGCAGTTGGCAATCAGCAGCTTCTTGCGGCCCCACA
AATCGCTGCATCCCCCGCAAAGCAAACTCCCGAGCATGGCGCCGAAGATCCACGCGTTCACGGCGAAAGTCCATGCCAGCTTCGAGTGGCCGGGGAACAT
GAGGCACGTGCCGTCCGCAACGGGGCGAGCTTCGCACTCGGTGGCGTCGTTGAACTGGGCCAGATTGAGCTGCGACGTGGACCAGCCGCTCTGGAAAGGT
TGGAGCAGGGACACGAGAACGCTCAAGTAGACGGCG