Description :
From Genome Similarity Track
Location :
contig_46:914- 7841
Transcript NameFunction/comments
g9557.t1hypothetical protein
g9558.t1hypothetical protein

Sequence
6927 bases(100 bases per row)
CCGTCGCGAGACGAGGACGAGCCTATGGAGGCCAACGTTGTCTCCAACAACCTCGACGAGGTCCAAAGCCAGCAACTGGCCGCGATGGAAGAGGCGCCCC
GCGCCCAGCGTCCGATAGCACGGCCTCTGCTCCACCCAAGCCGCCGTGACTACGGCTTTGAGCCACGCGACCCCAACGAAGTGGCTCGCCTAGCGGCGTC
GCAACTGTTGAATGACTATGTCATCGGACCCGCGGCCCATTCCAACGAAGAGGTCGCTCAGCGAGAAGACCTCCGCCAGAGGTTGCTGACGCCTCAGCTT
ACCACTCAACGCGAGTACCGTGAGCGCCTGCAGCTCCAAGCCCGGGGGGCGTCCGTGCCGCAAATGCGGACGTATCCAGTGGTCCTACTGGCTGGCGAAC
GCCAGGAGCAGGATGTCGCTCAATTCGAGCTCTGGGTGGAAGGGGCTCGTAAGCTCTCTTCCATTGTCGCGCTGCAAGCTAGCTTCAAGAAGGACGACGT
CCTGTTAGAGCGTCGGCTCCGGTTCGCGTTCGCGAAGTTAAAGGCGAAACGCCAACTTCCTTCGGGCTTCCAGCCCCGCCCTGCGCGGGCTCCTCAACAT
GCTCTCCGAGCTCTGCAGACCTTCCACAAGGTGGATCGTCGGCTGCAGCAGCCCAGGGTCAAAGCTTGAGCTCAGCTGTTGACCCCCTCGCTCCCCGACC
TACTGCCGGGAAGCGGGTGGCGACCGACGCGCCGGTCGCGAGCCCCCAGGGCGCCGTCGATCGTTTCGATCAAAAGCGTCCACGACGTCAGGGCAGTCTT
GCCGGAGGGGTACCTCAAACTCCCATGAGTTCTGCGAGTGGGGGTACCCTCGCCACTTCACCAGATACTGGTATTGATTTTGGCGGCGACGCCGAGCCAC
AATCCGTTCCACATGGAAGTGGCGATTGCCCTGCTCATCGAGCAACGCCGGTGGCGGACGCTGAGTTGCACTGGGTGCATCGTTCGGAGCTTGAGGACGC
TTGGAACGCGATGGGATCGCTGCGCCGGGAGGTCGTACGTCTCCGTGAGACTCTCCATCAGGCCGAGAACGCCTATGATCGCTCATGGCATGAGATTGAT
CAGCTCCGGGAGCGCGTCGACTGGTTCGAGGCCCCAGCTGCGCTGGCGAACCGGGTCTCCGACCTTGAGCGAGGTCTGGCGAGGCTGGAGGGTCAAGTCG
ACCTTCTGCTGCGACTTCAGCAGGGTTCTGTGGCTGTGCCACCTGTGCACGTCCCGGTGCCAGCGCCTCCGCGCTCACCCGCGCCGGGTCCCGGTACGGC
TTGAGCAAGCCCACATAAAACACCGGATGGGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCTTGGCCACGACTTTGAAAGGTCCGA
TGAAGCGTGGGCGCAGCTTCGTCTTGAAGACCGCAGAAACTGCATGTGTAGGTAGGTTTTTTGCGTTTAATAAAACCAAGTCTCCGACTGCGTAACTTTC
AATGTTACCTCTGCCCCTGGCATCTGCGTTTTCCTTTTGTTGGTCTTGGCTCTCAGCCATAGCGTCACGTACGTGTCGAAGGACACTCAGACGCGTTGAC
AGAAACTCGTCAACCTGTTTACGAACAGTGAGAGGGCTGACATCAGCAAGCCGACCGGCTATCTCTCCCCCACCAAGCCCGGAACCACGGAGTGGTAGCG
TCAACGGGACGCGAGGGTGGGTGAGGCCATTCACGTAGAATGGGGTAAAGCCTGTGGAGGCATGAACAGCATTATTCAATGCGAACTCCACGAGTGGAAG
CATGGTGCTCCAACGCTTGGGCGTTTCGGCGCAAACGCTGCGGAGGACGTCCTCCACGACGCGATTAACGCGCTCGGTCTGACCATCGGTCTGTGGATGA
TCCGTTGTGGACATGTCCAATCGGGTGCCCAGCACCTTGAAGACGGACGACCAGAACTTACCCGTGAAACGGGGGTCTCTATCCGAGACGATCGACTCGG
GCAGCCCGTGCTGGCGGAAAACCCGGTCGATAAACAGCTTGGCTGTACCTTTACCATCAATGGTGTCCGGCACCGCCGCTAGATGAGCCATCTTGCTCAA
ACGGTCGACAAAGACCACGATGCCCGTGTTGCCATCCGAGTCCTTCGGAAGGCCGAACACAAAGTCCATACTCATGGACTCCCAACACCCAGAGGGTACA
GGCAAGCTTGCCAGCGGCGCGGCCGCATGCGGTGAGGGCTTCACCCGCTGACACGTCTCACACGTGCGCACATACGTGCTCGTCCACTTGTAAAGCTTGG
GCCACCAATAGGAGAGGCTCACAGAGCCATAGGTCTTTTCACGACCAAGGTGGCCACTAAGCGCAGTGTCGTGTGCCTCATAGAGGATACGATATTTCAG
ATCCTCATCGTGAGGGACCACAATACGTGGAGTATCCTCCGGATCGGTGCTGTAATACAGCAGGCCATCATCGAGCGAATATCGATGCAGCCTCGCGCGT
AAGCGCGCCGACAGCTTACAGTCCGAGTCTCCAAACTCCTTGCTCCCAAGAGCACGTAGCAGAGCGACACACATGTCGTCACGCGCATACGCAGCGCGGA
TCAAGTCCGTCACGGACGACGTCACAGTCGTGACATGAGATAACTCATAGTCGGGTCTGCGGGACAGCGCGTCCGCTAACCCGTTCTGCCTGCCAGGCTT
GTACTTCACCTCGAAGTTGTACTCCGCAAAGAAGGAGAGCCAGCGGGCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGCATGA
TCAGTAAAGATGACAAATGGCTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGATAGT
TCTTCTCTGCAGCTTTAAGCTGGCGAGACTCAAACGCAATTACGCGTTCACGCCCTTCGGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAAGTCCGA
TGCGTCACAGACGACACTAAACGGACGATCGGGGTCTGGCAACGCCAGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACTTGATGC
TCGGTGTCCCAGGCCCACTCCACATCCTTCTTAAGGAGATTGGACAATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAATAGTTGGCGA
GGCCAAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGAGGGATCCGCTCGAAGGCCGCGCTTCCCGAT
GAAGCACCCTAAGAAGGGGATCTCTTCAGCACCGAAGATGCATTTGGATGCGTTAGCGTACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAA
TGGTCTATGTGGTTGTCCACATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGCCCGATGGGGCCGGA
AGAGCTGCGTCACTAGACGATTGAACGTCGCGGGCGCGTTCGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACCGC
TGTCAGCGGAATGTCGCTCGCACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCATGTTGTTCTGGAGA
ACATCCTTCCTAGGAATAGGCGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTCTGACAC
AGAATGTCGGCGTCGAGTGCGGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTTGG
CAAGGGCCACTGCCTTGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGTTG
GAAACGACATCTTGGTATTCCTTAACCAAGGGATAGTACGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGCCTGCTTCGTGT
CCTCCAGGACTGTTTCGTCCATAAGGGACGACGAGTTTAACTCATCTTCAGGTCGTATAATAGCGACCTCGGCTAATTCGCCCGCCTTTAAGGCCTCGCC
GAACTCGGCAATTGACATTTCGTCCAGCTCTAGCAGAGCATCTGCGGCGGGAACAGCCTCAAGGCTGACGTCGCCAGCGACCTCGCCGGTCACTCCATTA
ACGAGTGTATATAGCTGTTCGCTATCCACCACCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTCTCGCAGCTGCCACACGGCGTCGCTGCCGTCT
CCTCGCGGAGACCATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCACCTCTTGTTGCTTCATCGGAGCGTCGACGTCA
AACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCCACTCCACACGCATCGTTAGGGCTGGGCCCAGGATGCCTCG
GCTCGTGGCCGACCGCGCCATCGTTGGCACGCAGCGATTCTCCGCCATCGCGGCGCTCACCGCTCAGCGGATAACGTGCCGCTCCACGCGCATCATCAGG
GCTATGCCCACGATGCCTCGGCTTTCTGCCGACCATGCCATCAACGGCCTGCAGCGATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTGCC
GCTCCACGTACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAACCAACTCCGACACGCCGATGTCCAGCACGTTGACCGTCTCGGTCCAGT
GCTCGCGCCAATAGCGCTTTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACCT
CCAATCAATCCATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGGATGAGATCATATCTCGAATCCAGGTCAAGGACCAGACAGCGTTCAACGCTATCG
AAGTCCAGAAACTTCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACGCGGGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCTA
CCAGCGCCTCGGCATACTGCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCCGAATCGATCAATATCGTCCACGGCTTATCAAA
GCCCTTCACGGTCGCTTCAACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTCCT
TGCTGAGGCTCAACAGAACTTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGAGCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAGG
GCTTCGGCTCGCCGGAGCCTGGCGCTGCTTACGCAGCGGGCACCCTGGTCGCAGGTGCTGGGTGCTCCCACACACGAAGCACCGGCGGATGCCGATGCGC
TGCTCGGCAGCAAGAAGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGATCCATCGGCTCGGGCCCACCCGAGGAGCCGGCGGCTCCGGATGAGTTCGTCT
GCGACGTTCCCCACCCGGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCAACGCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGGAATAC
TTCCGTTCTGGCCACGCCAGTGCGGAGGCCTTCCATGAAGATGGTCACCGTGACCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGTTCGTAA
CTCTTGGACGAAGTCCACCAACTCCTTCTTTCCTTGGCGGGTAGCCAGGAAGCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACACTCGCGAC
AGCTGAAGCTTCAGCTGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTGCCACACGTTAGGGCCCACTCCCGGGCCCGGCCACCCAGCTTGGACACGG
CCAGCGCCACGCGTTGTTGCTCCGTCTGGAGTATGGCGGACGCCATGGCCATCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCTTGCCCTC
AAAGGTCTTCACGCTCACCATGAGCGGCTTAGCTCGTGGAGCTCCATCCGATGCCGGCTTGGGCGTCGTAGACGCTGTCACAGCCGTCATCTTCTGTTGT
AGATGTTCCAACAGAGCATTCTCATAACTCGAGAACGCCTCCAGACGCGCATTAATCGCGTCGGGGCCTTGCGAAGCAAGATGAGCCACACCTTCCGGGC
CCAACAAGGACATCAGCTTTTTAAGCCCGTCCTGTTGGTTGGGGGTAAGTGGGCAAATTGCTCCATCCTCACAGAGGGACAGTCGTAAGACTCAGGTGTA
GGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTGCGTCAGAGGAAGACGTAGACTCTCAGAGTCTTAGTTCGGTTGTAAACCTTGGT
TCTATACCAGAACCAAGTACAGTCTGTAGATATGCGATCTACAGACTCCTAGAGTTATTAATACCTTAAATAAGGCTAATAGACACTAGACTTCAAAACG
TGAACTGATTTTTATTGTTGTTATTCGCGGCAGGGCCGCCAGTGGGGTAAATGTATAACACTCACTATCTACCATAGTGGAGCCTAGTAATATGCATGAC
GGGTGGCTGTGAGGCCACCAACCTAAGTCTCGTGTACACACACCAACTTGGGTGTGCACACCATTTGTGTGAAACACACTATTCGTGTACGATACACTAA
CGGGTACGTGTAACCCCGTTACAACCT