Description :
From Genome Similarity Track
Location :
Scaffold_21:91398- 97027
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G008268Protein of unknown function
Pytul_DAOMBR144PYU1_G008267Similar to TPRXL: Putative protein TPRXL (Homo sapiens)
Pytul_DAOMBR144PYU1_G008266Similar to EID3: EP300-interacting inhibitor of differentiation 3 (Bos taurus)
Pytul_DAOMBR144PYU1_G008265Protein of unknown function

Sequence
5629 bases(100 bases per row)
GCTCGCCCACGTGCCTCTGCGATAGCACGGGGTTGTCCTCGTGCCAGTGCTCGCAGTGCTACGTGCGGCAGGCCAACGGCAGCGTCCAGACGTTCGCCTA
CAGCTCCGACGGCACGTGCCCGTGGAGCGGCACCGACTGCTGTACGTACCATCCTTATCACTTCACGGCCTTTATTTAATTTACCATATGTGATGCTCAC
ACACGCTTGTATGTGGACAGCCACCTGCGAGAAGAGTTCTTCGTCATCATCGGGCTCCAGTACGCCGACCAGCACGCCGACCACGACCCCCACAAGTAGG
CCCCTTTCTCCTTCCCCAGTCGCCCTTCCTTCTCCGTCTCCTTCGCCTGTACTGACACCTTCTGTCTCTCCTTCCCCCGCTCCGACTACGGGCGTGCCTT
CCCCCTCGCCAACGCCAACGCCAACGCCGACGCCCACACCCACAAATGCTACTTCCACTGGTACTGTCCATTTATTTTCTTTGATGTTTGGGATTTTGGT
GTGCCATCTTTGGCTCCACTATGACGCTGTTTATTGAAACGCAGCGACGCCAACTGCGACGCCTTCTCCGTCCACTGCAGCAGGTTCCAATACAAACTCC
AACACCAACAACACCGGCAACATGGTCGGCAGCTCCTCCAACAGCGGAAATAGTACGTTGCAAACGCCAACAATTTTACTGCTTAATGAGTATTAAACGC
GTGTTCACTTTTTATGGCAACAGATTCTACTGGCAACAACTCGTCGAGCAGCAGCAGTTCGTCGGGCATGCAGACGTGGCAGATCGCGCTGATCATTTGC
TGCGCCGTGCTCGTGTTCATTGTGGCCATGTCGGCGCTGCTGTCGTGCTACTGCAAGACGCGGCGTCGGCTCGTCGAGAGTGAGGCGCACGCCGAAGACG
CCAACTACTACGCTGTGGGCGCCTCCGGAGCTGCCGGCGTGGGAGCCTCAGGCGCTTCGGCGGCCGCGGGCATCGACTCGTACGGGCCGAACCAGCGCGG
GGGCAGCGCCGTGAAGTCCGGCGCCATCTACGGCGAGCCGTCGTCGTACACGTACACGTACGCGTCGAGCGCGGGCTCCGCGACGCCGTCTCCCGAGCGT
GCGGGCCCCGGTCCGGCGTACACGAGTCGGCCGTCGTCTGGCAGCGTCGGCGAGGCCACGACGCCGTACTCATATCGTCCGAGTCAGTCGCAGGCCGTGA
CGCTGTAACGGAATAAACGAGCAAGACCGTATAAGTGCCGTTTGATATATAGACACGCGAGTCCCGACGTCCCCATTAGTCCTTCCCCACACGTAACGAG
TCCATTTTGTCACGTTTGATAGTAAATATATAAAAGAGAAATGTGAAGCTGCACAAAACGCATTCATGGAGCAGTCTTAATGTGCAGGTTGTACGTGAAT
AATAATGCACCGTATGTGGACTATATACGCACGCAAATGTATGCGATAATATGCACGCATATGCGATAGTGGAGGATCATAATGATGCGTGTTCTCATGG
ACGATCACAAGGCGTCGACGCATGTGGCGCCTCGCAGCGGAGGCCGTCGAGAGCGCCCAGAGCGGCACTCGACCGAAGAGCGGCCTCGACGCATACGACG
GCGCCGTCCATCCGCTCAACTCTCTCTCAAGATATGTACGTGTGTATAAAGAAAGAGGAGCAGTGCGCGCACCTGCGGTGTCCGATCAACAGTATCTGAA
GCATATTCGTTCCAATCATTTCCCCATGTGACCATATTAATAGCGACGACACTAACAGAAATGATTGTTTCGCTTAAGTACGACACACAAGTGGACCACA
TATAAATGAAATTAGACGGTATGCAACATTCTACAGAAAATTATAAAATGTGCGATACTCTGTGTCAATAGCAACGGTTCAGAATGAAGGGGCTATCCGG
TCTTTTGATGCTTCATGGCGCATCGGGTAATGGTTACAGGCGCCTACAGCAACAAACAACAGCCTCATTCGGGTCTTACGTTGCGGCTTCCAAAGTCACA
AGTTTGAATCTACCCAACGCATCGAGCAACATACTATGGAGGCATCTGTAGAAACCACATTCATTAATTTCGAGACTGCACCAAGTACATCAGTGTGGGT
CACACTAAAAGGAGACTATGCAGAATGATGGTCGTGCATTCATGACTCGTTCCCGCGCAAACCAAGCAAGCACGCCACTAAACACACTGCCAGAGGCAGC
ATGGAGCGCGTGGACGAAGACGCGGACGAGACGACGCAGGAACAGTCGGCGCCGGCGGACGAGCGTTCAAGGTCGAAGCCCAATGACGTGGCGGGGCGCG
TGAAGAATGCGCGCAAGCGCGGCTTCCTCGAGAACTCGCAGCTCACGGAGAAGGACCGGCGCCAGGTGCGCTACAAGGAGCGCGAGCTGCTGCAGGACAT
GAAGGAGAACGCGAACGAGCTTGCCAAGCTCACATCCGACCGCTTCCAGACCACGACGGAGCAGCTCGACGAGATGTACGACAACGTCTGCTACCCGCGC
GAGGCGAATCTGGATGCGTCCAACCTCGACGAGCTGAACGCCGCGGTCGCCAAGCAGAGCCAAGCGCTCGGCGCCAGTGACCTTACCAAGGCAAGCGCCA
TACGAAATCCTACAGTGAGTGCGTTGCTATATTGACTCTTATTTTTGTATATGTGCAGTACGATGTGGCCGATTTGATCCGCGCGACCCGCGAGACGTGC
GGGTCTGAGGCGCAATTCGACTGGGCGACGCTGGGGTCGGCTGCCGGCGCCTGCTTCCGATCGGCGCCCGAGATCAGCTTCCTCTTTGGACTCATGGACA
CGAAAGTGGTGCACAAGGAGCGCAAGAAGGCGCGACGAACGCGCGAGGACGACGACGTGCACGCGACGCAACCGAGCGAATACACGAGCAAGGTATGCTG
TGCATTCTCATACATTTTTGTCTTTATGAGGTGCTGATTGCTTGCGCATTGCCTTATCGCGTATTGTGGCATCCTATAGAAAGACCGAAAGGATGCCCAG
GCGCGCCGTCTCGAGGTCCTGCAGAGCACCATGGAGCAAACGCGGAAGAAGCACCTCTTTGACGTCGTCGTGAACCCACGCAGCTTCACGCAGGTACCAA
CGTGTTGGGCTATTCATTTTGTTTGATGTGTACACTGACACATTTGACAATTTTGTTTTTGGTATGCTATCAGACTGTGGAGAACCTGTTCGACATGTCG
TTCCTGGTTCGCAACGGCGCCGTAGAGATCGGCGTCGACAGCGTGGGGCTGCCGTACCTGGAGAACCACGAGGGCCGCGCGGAGGAGAATATTCCGGCGC
AGACGCAGAGCATCATCAGCATCACACCCGCGCAGTGGGAGGAGATCTCGAGCGTCTGGGGCATCGACGAGCCGCTCGTGGGCAACCGCTCGTAGTCGGC
TTTGATGGCTTTTATTTCAAGCGCATTATGTAAAGTACCCAGTCTCCAGCATTTTTTTCTCTTTTTCTCATGAATCTACTGGCATTTCCACAGTTATAAT
GGCGCAGACTCACGGATCTGAAGGTGCTCAGCGTGGAGGATGATTATGGAGAGCCTCGCCTTACGCTTCATTGGTGCCACGGACGAATCCATTCACGCAG
AAGCGCGAACGACGCGACGACCAGCAAAATTCCATTTTGAGTCACTTGGTTTCGAAATTTTCACCAAGTCGAAAAACGAGAGCGCCTTTTCTTTGCTGAT
GGGTGCCATGCTACTAATCAACAATCAATTATGCTAGGTTGCTTAAAGGATTCGAGTGCCACCATGAATACATCGACTATAAATAATTATAGATTCATGA
AGGACGCATAATTTACATGTACGGAACGGATTGACAGGATGTGGGCACCAATCAGCAATACAGCACACGCGCTGGTGAGATGCGCCTCATTTTCGCTTTG
TTGCGCGGCTCTGAACGCGTCACACACCGCAACTCGGTCCTGAGTGTCTGCATCGCTAGCGCTGCTTAGCGCATTTCTTCACCTTCAGGTAGCAGACGAG
AGTAATGGCATTCGGCCGACGGCGGCTCGTCCCGCTTTGGACTCCGCTTTGTGCGGTCGTGGCCGCTCTGACAGGCGCCGATGGAGGTACGCATTGTGTG
CACGATTATAATAGAAAAAAGTGATTGCCATGCCGTGGTCCTGTCCTTATTGACATGAACGCTGTGTGCCGATCGTCTACAGTCCAGCCCCCGTGCCCAC
CGATTTGTTATACGGCTGCAGTGTACACGTACATGGACGTTGGCACCACGTGCGCATGCGTGCTGAACATGAGCACGTACGAGCGCACGCCACTCGACAG
TGCGTGCCAGTGCCCACAGTGCTTGTACCAGAACGGCGACGGCGTCTACTCCATCGCCGGAGCCAACTGTCCCTCATTTGCTACCGATTGCTGTACGTGC
TTTCTGCTTTCTCTCATGCTTGCACGTCGTCGACTTGGAGAAATTGATTGCTTGTATTTATGTATTATGTCGATCTCGGTGAGCAGCGACTTGTGATTAT
GTCGGAGATCTGGACAGCCCCATGAACGCAACCTCGATGTCAGCTCCTGCTGCGACTCCGAGTCCTGCGCCTACTGCGAGCCCCAGCACCAGTGCGTCTC
CGACTTCGACAGTAGCAGCAACAGCACACGCCTCGTCTTCTTCGGGCCATGGCGGGTGGAGGAATGGGCTGTTTATCGCGATTTTCGCGTGCGGATGCGC
TTTGGCGGTCGGCGCCGTGTTTCTCTTAGCCTGGGATCTGTATCAGCGTGCCAAAGGCGTGAACGCCGTGGAGTCGGACGAGACCGAAGATGAGCATCTC
TCAAACGGAGAGCTCCGTGGGGCTCCGATGGCTTCATCGTACGCCCACTTGCGGGACTCAGACCAAGTCTACGAGGTGCTCGTATATCCACTGGACCCGC
TCGCTGAGGACATAGACCCGCAACGGCATCTTCGAAGCAACATACAAATTCACTAGCAGCAGATTTATACATTAAATTGATATGTGCCCACTACGAACAG
ATTTGGTTTTCAGAACGGTGCGATTTTAATAAGAAAGGTCATTTTAAGGAGTGCATAAAACCTGACCTGACCTAAAAATGAAGAGGGATCGTGTCGACCT
GATGCACACACCCACTGCGAAAATACTCTGCTGTTATGTATCTTGGTCAGTCAAAATTTGACGTCACACAGCGCAAGGTACATAAGCAAATTTGCGTGGC
TGTTGTCGTGGATATGCTTGGCGCATTGATCACCTGTTCATTATACGCAGACGACGCGTACATCTATTTCTTTATAACGAACACACCACCGGCGTACTCG
TATAATGCTACTGCTGCGACTGCTGACGCCGCTTCTCGGGGCCTTTGTCGCCTTCTCCAGCTTGGAAGCAGGTATGCTGTGCATACGAATACATATGCAT
ATATATGGAGCTCTTTTTTGTGTCGTAAACGACTGACTGCTTATATATTATATGCTGCTTAGCGAATGCGGCGACGTGTCGGTCGATCTGCTCGGCGACC
GAAGTATACGGCTTCATGCTGGGCGGCTCATCCACGTGCCTCTGCGATAGCACGGGGTTGTCCTCGTGCCAGTGCTCGCAGTGCTACGTGCGGCAGGCCA
ACGGCAGCGTCCAGACGTTCGCCTACAGC