Description :
From Genome Similarity Track
Location :
Scaffold_21:91372- 93995
Transcript NameFunction/comments
Phyke_g1374hypothetical protein

Sequence
2623 bases(100 bases per row)
GCACCGAAGTTCAAGAAACCAGCGAACACGACTCAAACGATCAGGAGGAAAATGAAGGCCGGGATGACGCTCCACCGGAAGAAATTATTGTTCCAGCACC
GGAGCCAACACCTGCCGAGCGCAACGAAATCGAATCGCCTAGGGAACCTACTGTCTCGTTTGGTACAATAGTTTTGACAAAGTTTGCCCAGAGATACCAC
GAATACGTCACACGCATGCAGCGTGAACTCGCGGTGTCCCGAACTATTGCCAGCACGGACAGCTATCATTTGGTAGTGGTTCAGGCCACCCAGTCGCTCA
GTGCCATTCGAGACCACTGCATCCAAGTGATCACAGGCGTAAGTAGAATCGTAAATTGCTTCACGGGCATTTTCACTTATTTAACGCTCGTGTATTTTTC
AGACGTCACTGGGTCTGTTGCGCTTTAGCGTATCACGTGAGGCCTGCCCCGTACTGCTGCCCGATGATCTTAGTAATACTAGTCGTGCTGAAAATATGAG
GTGGTTGCTTTATGGAGACTGGACCACGCTTctcgaagctgaagaaaGTTCCACCACAAATATGTCGTTCACCCGGCTGCCTAAGCGCAATGCAAAACGC
CGATTGCTATCCAAGTGGCGCGAGTTTTGTCCCGTGGCATCATCTGCGAACAATGAACTAACACTCGGTAGTCCAGAGTTTGCTGTATGCTACTCTGGGC
GGGTCTACCTGCTAGCCTCACGAGAAGCGAGGAGCGTCTTCTGCGCACATCCCCTGCAGTTCTTGCGTCGAGACGTCCCAGTTCCGTCAAAGTTTCGCAA
TTATTGGCTTGTCACCACAGGTGGTGGCGATATTTTGTCTCCTGCGCACTTGGAGACACTGGAGGCAGGACTTCGCGTGCGAACTGTATCAGCCTCAAGG
CTCCTCAAAACTTTACCAATATCCATGGAAATGCGTCTCATGAGAGGCCAGGTTGTTTCCCCTGTCGACGTTGCAACAGTAGCAGCCGAGGCATTAAAGG
CACAACTGGCCAAGCTGGATGCGTCCTCTGGATGGATGCTCACGGATCTGCCGCTCACGCGCGACGTCGCTGCCGTGCTCCTCGAACATGGATGTGTACC
TGACGCAATTTTGttgatggacgaggagcttACCGCTGCTAAAGAGGAGGCGGAAGTCATTAGCCCCTTGGCTGCATTACGGCGTCAGCAGTTCCAGACA
GAGAAAGCTGGCATCGAGGATGTTTCCCAAGCTCTCGGTGGCACAACTCGAATCATAAATTGTCCATTATTTCATCAACCGACCGAGACGCTGGCGGCCA
TTGAGCGCGAGCTTAATCCTCTCGCACCGCGTCTGGACAATATTGAGGACGGACATGCGCCACAGATGGTCGACGAATATTACCCAGCGGCGATATTTGC
CTCACCACATCCAGGCAACtatgaggaggacgaaggaAAGTTTGTGTCTTTATCACAACAGGATGAAGGCGACGCTCCTGATCCTGaggcagttgcagca
gctgaagccGCAAGAAAGACATCGCTTCAGCTCCAGGGTGAGACTGGGCGATTCTGTCCGGTAGCGTGGCGTACGCGCGGCGCGATAATACCTGGACAGC
CATCATACGTTTGTTCGTTCCGACAAAAGTTTTATGCCTTCGCAGGAGAACAGGAGCAACGCGCTTTTGAGCGAAATCCAGCAGCTTACATCCCATCGGG
ACCACGTGCTACTGCTAGTTTTGTACCATGTGTACTGCTACTTGGTGTGCGGGGATCCGGGCGGAGGAGAATTGCGGATGCACTTGCACCGACCCAAACG
GAACTCGGTCATGCACCAATGGAGTACGTGAATTTAGACTTGACTGCCGTAGCAAGTGATGCTGACCGCCGCCAACAGCTAGAAGAACTCAAATCCGAAG
ATGCGCGCATGAAACCCGAAGAATTATTTGTCAGTGCGCTTCAAGCCGAACTGAAGCGGCAGCAACCTGTTCCTGGGGAGGCTGTTGCACATGTCATTGC
TGGGCTTGGCCAGGATCCTTCACGTATCCCAAGTGCAGCGACACTGGAGATGTGCTTTAAGTATGAATTCTTCCCGGTACTTGTAGTTCCCCTGGTCATc
tcggaagatgaagcagtggCTACTCTGCTCAGCCGATGGACTGACAATTTACCGGTCCCCCGTCGAAAGCTTGCCCTCACTCGAAAAAAGGAgaaagatg
gagaagctggtgatgacggcgatgcactggaagaagacgacgaggaggaagaacctCCCGTAGATTTGGAAGCGGCGCGAGAAGATGAAAGTACGCGACT
GCATGAACAATTCGTCGAGGAtcagaagatgctggatgaagccatCGTTAGCCTCCGGTCTCGTGGCGTCAGGGTATGTAGTCCGGTCAATGCGTCAAGC
GCACCAAGACAAACATCCAAACGTATAAGTCGTATCTTGAACGAATTTATGACAGGACGAGAAACGCTTTTTGAGCGCTGCGACGTACTAGATATGACAG
CGGGAAGCACAATGCACCAATTACTTTCGTCAGGGGAGCTGCTAGTCGGTAAGCATGGATTTGTGTGCCCCGTGACAGGACGTACAGATTCTCTCTCAGC
CACATCAACCATGGCGGTGGTGT