Description :
From Genome Similarity Track
Location :
Scaffold_210:91366- 98345
Transcript NameFunction/comments
Hyaar_Emoy2812642hypothetical protein

Sequence
6979 bases(100 bases per row)
AAGCCTAACACCATATTCTGTGTGACTTGCAGGATCAACAAACGTTTTTCAAACTAAACATGTATCGTTGGTTGGTGTGGTCGGTCGCTGGCTTCATCGT
GTCCTATACCGCTCTTACGGTCGAGGCCATTTTCAGTCGGCTAAGTGTAATTGAGTAGGACGTCGAGTGGTAGTGGATGCAGCTTGCGAGAAAATATTTA
TTATGCTAGTTAGAGTAAAAAATTGTGTAAGCTAAGCTGAGTCGAGGACAAATACACCGGCCATGACCACGGCACTGCAGGTAGCCCTCCCCCCACAACA
ATAGTCCACGGGGCGCAAGACAGCGAAACGACGACGCAGACCGCAGAGCAGAGATGAATCCAAAACGTAATTGGCGAGGACGAAGAGCAAAAATCCCGCG
TGTATAGCTGGAGAAAAGAAGAAAATAGGAAGTAGTGAAGGTAATGGGATTAGACCAAAATCTTAGGTCATGAAATCCAAAAATAAAGCTTCCTCACAAC
CACGGTAGTGTTCGGTAAGAAGAGACGTCGTAGGGCCTAAGAAGTGAACCATAAGAGATTAAACGAAATTCATCGAAGCTAAGTACGCTTTCCAGGAAGC
TATAACTACACTGTAGGAAGTATCTTCAGAAATCAGTAGTGCCACACCGGTCGTATTAATGAAGCTAATGTTGGGCGAGTCCGACCAAATCGTCAAAATA
GTTTCAATACCGGAAAATACACCAGAGCAGTGATCGTAGGTGGAAAATCCCCCAAGCACATTGCAAGAACCCAAGTGCGGAATCCAGGTTGCCGTATAAA
CAATGTAAAAAAACGCCAGCAATTCGTATTGCCGCACCGGAAGTGGTGATGTAGCTAATATCGTGCGAGATCAACCAAATCATCCAAACATTTTAGTATC
AAAGATACCCCAGTGCAGTGGTGGTCGGTGGAAAATCCCTCATGCACTGTAAACTAACCCAAGTGTGCATTCCATGCCGCCGTAGATACGTCAGCAAGTA
CCTTCAGCGATCCGTACGGCCGCACTGGCCATAGTGATAAGGCTCATTTCGAGCGAGGTCGACGAATTCAATAAAAGTTATTGTATGGGAAAATATACCA
GAGCAGTCGTAGTTGGAGTTAATCCCCCAAGCATCTCTAGAGAACTCAAGTGAGCATTCCTGGTAGCAGTCGAACACTATAGGAAGCAAAACCAGCAATC
CGTAGTGACACACTGGCCGTTGTAATGGATCTGGACGCAGCTTGTAGCCTGGCCAGTGCTGAACTTCGTTGTGTCAGCTGCTATGACTTTTATTTGGCCG
CAGACACAGAACAGCTCGCATTTTGCGTACTCTATTCACGCATGTGCAAATGCCGAATTTTTATCAGTCCTTTTCATCTCTTTATAAACTGCTTAGTTGT
GTAATGTTGTACCCCATTTACCGATGACGGATAGTCCAGGTCTCGAGATACCACACATGGCTCGTCGCTTGAGGATGACATCTATCTGAGATTTATTCAG
ACTCGGATGAAGAGTTCTTTCGTAGTCCACTTACTGAGAAGAAGAAAATCGACAACGGCAACGATTTCGACGACGTGGAAGGGGCCTATCTAATTGCACT
TGTCTTTGCGATTCTGGCGTACCCACGCCTTGCGCTCTCTTCGGGGAGAATTTATCGCTGATGATGGTCTTTCTCCATCGGGCGTTGCTTTGACATCACG
TACATCCGGTTGATTGACTGCACTTGTGGTCTTCATTACACCTATGAGTTAAAATTAACGTAGCCTACCCACACTTTTGATTCACAGGATAGCAAGTGAT
GACAGCATAGGTTTGCACCGAATTGGTTAAAGTGGGTATGACATCAACGTGTAAATATAAGATCTTGATAATACAACACACATAATATATGCTGCTCACC
CTGTAGCTGATATTAAGTGCTCTAACAAACCAATGCTCATGAATCGTCTCTTGTGAAAAGCTTTAAAAGAGGTTGTCAGAGAGCCATTTGAACAAGAATT
AATGTGTAGTTGAAGGAAGTTTAATTTCGTGAGATGTCATCTAAAATGTATGTAGTTAAAGACTATCTTCTCCTACATCAACACTCCAATGTTTGACACA
GCACTGACAGCATCAAGTACATAATCTAAATGCGCGATATCCTCGATCTGTCGCAACGCTAGGGGTGCTGCAGGAGATGCTTGTGCTTGTTCCACTTGAT
GACATGTTCTTGCGTTGTGTCCTGAATGTTCACAGCGTCCGCATCGTCAACGTCGCGTACGATTAGATCCATTCTCTAAATGCTCAAATTTAGAAAAAAA
ATTGCGGCGGGTAGAACCTCTCGGGCACCCGCGCGTCCTTACCATCACAGGACCACGTATTGCGGAACCTGGGGCAGCAATAGCACGATCGTATAGCATC
CTTTGCTGAGGTCTGTCAGCAAGCACATACCTCTCACGAAGTCCTTTTAACACGTCATCCTAATTGACAACATCACCTCCGCCTGGCTCGGTGTCAGTCC
TTCGTGTCGAAGGTTATACTAGCTACCAATGCTGGTCTAAAGCTTGTACTATCAACGCCCATTGCAATCCAATAATTGCATGACGACAAGAATGGCCATG
TTCTTTATCACCAGATTCTGACAAGGTCCTGGTTCAAGTCTCTTAATCCTTTGACGATGGGCTGCCAGTAAACCTGCAGCGGAAATCTTGCCCATTACTC
CTGCAAACAGAGGTCCTGGATGCATTTAGATGATGTCGCTTTCTCTTGCGTTTTGATGGCTAACAACAGCGAGTTGGCCGTGGCAATCCAAGTCGAGAGC
CGTTCTTATTGACCACAGTTCACCTAAGGACAAGAATAATAATTAAGTAGTCGAACTACCAATATCGTCAGGGACAAATAATTCTACTTACCTGTGGAAC
CATTCAACCACTACTTGAGAGCCGCATGCGCGCTTCGACACGTGACGTTGTCGCATAACCAAGATGTAGAAACTAAACAGGTATCAAGTCACGAACAATT
TCTTGTAAACCAGCCAAATATCCTCGATATAACGCATTACATGAGCTGGTAGATCAACCCTCATCGCAATAATCTGGCGGTCATACTCTGTCGTTGTTTG
ATCTTGTACTAGGAAGTTCCGTGTTCGTATTAATGTTAAAACTCCTCCGCGGAGTCGAAGTGTCTTCGCATCTTGGTAATGATGTTCCTGTTTATGTGAC
ATCACCAAAGGAGTGTACTCTCAAAGGGGGAAGACATCTACCGGGCGCATTCACTAATGCCATCTCGCGATCAAAAACGAATGTTTTAGGTGTAGCGATG
TCGAACATCCCAAATACCCGCCTCAGGTTCTGCACCGCCCACAGGTAGTCGTCCTCTGCCTCAGGGCGCATAAAGAAATAGACACAGTGTAGCTGTTGTT
GGTCGCAGTGACGCCTACAATGTGCAGTAGAGGTAGTCGAAATCGATTGGTCTTAAAAGTGGCATCAATCAAAAATACCCGAGTTGCACTGAATCGGGCG
GTGATTTTCGTGCCAGAGATAAATACAACAAATAAGTGTGTGGGCTGCTGCTCAGCATCAAATTTCGCGTAGTACGGCGCATATTTGTTTTTGTTTGTTG
CTAGACTGTCAAGGGAGTGTGTTAGCGGGAGCTTTCCTCCTGACCATATGCAGCGCTCATTTGCGCGAATATTGTACATATCGCGCGCAATGACACCCAC
AATACCAAGTTGCCAAATGGAGGCAACGATGCGACCAGCTCTGACACCTGCACGCAGATTCGCAATCACTAGTTGTTCTTGGCCTTCCAAAATGCCTGCC
TATCCACGCGAATGCACCTTGCTATTTTTAAAAAAAATCATGGTTATGCTCTACATGGGCGACTTTATTTACCACTGGTCTGGTTGTTCTTGACGTCGCT
GTCGTGTGATCGTGGCCTAAATGAAGCAGTCAGTGGCGCGGCTGGATCCCATACGCTGACGAAGAGGTGCTATACCTGAATCGGCATCAGAATAAGGTCT
GCGGCAGTTACATGAGTATTGCAGATTCACTGCGTTATCTTCACCTTCCTTGCGGTTACACACCCTTTGTCGCCATTTAAGTGCTGTACCATAGCTTTCC
GGCAGTTTTAGCTCCTCGAGCACATGGCGGGCTTCGTCCACAGAACCAAACAGCTCTTCTGTGAGCTCGTTAATACCTTTCATGTTGCTTTGAAGGAAGG
AGGTCAGAAGTACGATATAGTAAGTGATATGAGATCAATGGACGTTGTTTCTATAACGTACAGCAAAACAATTTGACAATTTAGGCGGTATCAAATTCAA
TTACTTGTTTAATGTATGGTGTGAAGGCTCATTACCGGCTTCCTTTTTATATTATATATATTTAGCAAATTTATAAAAAATCATTCCATGAAATGGATAT
AGAACGGACGCTACCAGAAACTGCATCTTCGGTCACCTCCGCCGACAATGTCACTCAGCAAACAGAGGGTGCTGCAAGTTATAATGGCAGAAAAGATAGG
CTGGTTTTGGACGTACTGTATAAGGCTCAGAGAAGAATGTAAAGCGGTTTATCTGGTACCAAAGCTTCTTGGTGAATCAGAATTTGCAGAATACGTATGT
ATGTACAGCTACGAGTGGTTCCAAACATTGTTGCCGAGCATTTGATGAACAAGCATTAGATGCACGATAATATACCTGAAAAAGGGTGCAATGTGTGCAT
ATTTAAAACTAGGCGATATGAAGGTGTGTGCATCGCGTACGGTAATGTGATTGAATTTAATATGGTATTAGCATGATAACATATAACATAAACCTTATCT
AAACAGGCAGACATTGAAGAAGGCATTATTCAAACTTGTTCTAGATCATTCGCTGCCTTATCAGTTTGTGTAATATAGGCAACTGCGTGATCTTCTCAAG
CTTTTCAGTCCTGCAACAAGCTCTTTGTTGACATCCGCAGATACGATCACACATGATGTTCTGGTGATGTTTTACCAGTGTACATGTACGCTCTAATTTC
GCGGCCAAATACATTTGCTAACGTCGCTATTTGCGGGATGTAAAAAGATGAAAATGACTTTAAATAACCTAAACACCAAACTGCATTTTACTTTTCATTG
CTGGACTTCTCGAAAGCTTCGATTTATAATGGGAGTGACCGCTCATTGCATTAGAGACAAATGGAAGCTCTACAATCTGGTTGTTGCTGTATTGAAGATA
GAAGGAGATCACAGCAAACAGAACCTTGAGCAGCAGCTGCTCAATGTGTTGGAGGAGTTTAACCGTTTACTCAAGGTCTTTCGTATCTCCAGCGAAAATG
CTTTAACGAACGGCACAATTGCAACGTGCCTCGAGCAACGGTGTATCATTCCCGGATTCAGCGACAACATGCTTAATTTTATGGCTCATGTGAGAAATCT
GATAGCTAATACTGGTATCGAGCTACTTGTAACATTTGATCACCACTTGAATCAGATTATTCAAAAAAGTATCATCTTAATGTCCACAGATAATATACTT
GTAGACCAAGATAGAGAAACTGAAAAAGGTTACATTTTTATGAATGTATGGGCTCATTTTGTATATAATATGTCAAATTTTTATATTGTTTCAAGCAGAG
GATACAGTCGTATGTAGAGTTCGTGACTTTGCAACACATCAACGGTTCGCCGCAGCGACTTCAAAAACTTAAAATGCTTCCGGATTTGGTCGCATCAGAT
ATCAGAGCCAAGAAGACGGTGCAAGATGTAGCCACAAGGAAAAAATTCTACTTTGGAAATGTTGAAGCGTGCATTTGCGCTTCCAAAGTCATTGAATCTT
ATGTATACAGTGACGTCAAGCTTCAGAGATATGTGCTTATGGAACATGAATCGGCTCTTGTGCAAGAAGTCATCAAGCTGCTTGAACCATTGGAAGAGGT
AGTTGAAGAATTTAATGGACATTTATTAATTGTGACATGTAAATATAATCTTGTTTTTGGCTACGGTGCTTTTGTCATCTTTAAAGTATCAAACCAGTTA
CTGCAGCAGCACCTGTATATGCCATGCTGTTGGAGAGTATTCAAGAAGCTCTTCGCTCATATGAAGGTGCATTACTCGAATCATCAATTAAGCCATGGTG
AAGAAATTGAGAGCGCACAAGGAGAGAGCCGATGGTCAACCATTTTACAAGATTGTAACAGTGTTGGATACTCGAATAAGGATAAATTTCTTCAGCGCCA
TAACCCTGGACACTGGGAATAAACGTAATCTGCTTTTCAAGAGAGCTCAGCTTAAAAAAGCACTAAGATCATTCGAGTCCCGGTGTGGGAACATCTTTGC
TCGCATGATACCGCTCATCTTTCCTGACTGCGGTCTTGATGAAATAGAAGTACGACTTCCCGCAACTTGATTCTGTGACCACTTCGTACTGGGAAGCTGT
GTTCATCAGCATCTTCGTCGATACATCATGCGATGATAGTGTAACACTCAAGCTAGCATGCGACTTCTGCGATGGACAAACCGAGTGCAATATGGGTGTG
GTGTTCCGCATCGTAAGTACGCTGTCATACACTGAAGCCATATGGCAGCTTTCATCGTGTTTGCGTCCAAAGTAGCGTTTATATGTACACGAAATACCAA
TGCGAATGTGAGCTGAAAATGAGTATGGTGGATTCAAGCATCCACGATTTGTTTGTATCGTGCATTGATCAGCAGCATTGTGCGATCAATACGGTGATGT
GTTTGAGTGCTCTTCTGTTTGTATGGTGTGTTTGAACGTGTTGGTGTGTCAACTGGTCAGCTTTCCCATATAGTCTAGGCGGTTAGGATAGCTGGCTCTC
ACCCAGCAGACCCGGGTTCGAGTCCCGGTGTGGGAACATCTTTACTCGCATGATACCGCTCATCTTTCCTGACTGCGGTCTTGATGAAATAGAAGTACGA
CTCCCCGCAACTTGATTCTGTGACCACTTCGTACTGGGAAGCTGTGTTCATCAGCATCTTCGTCGATACATCATGCGAT