Description :
From Genome Similarity Track
Location :
contig_14:91349- 92353
Transcript NameFunction/comments
g3642.t1hypothetical protein

Sequence
1004 bases(100 bases per row)
GCTGCGCGAGGACCTGCTGCGCGGCATCTACGCCTACGGTTTTGAGAAGCCGTCGGCCATCCAGCAGCGCGCCGTCAAGCCCATCCTGCTGGGCCACGAT
TGCATCGCCCAGGCCCAGTCCGGTACCGGTAAAACCGCCACGTTTGCCGTGTCCATTCTGCAGAAGATCGACATCAACCTGAAGGAGACGCAGGCCCTGA
TCCTCGCCCCCACGCGCGAACTCGCCCAGCAGATCGTCAAGGTCGTCGTGGCCATTGGCGACTACATGAGCGTGCAGGTGCACGCCTGCGTCGGCGGTAC
CGCCGTGCGCGACGACATCCGCACCCTGCAGCAGGGTGTGCACATCGTGGTGGGCACCCCCGGCCGCGTGGGCGACATGATCAACCGTCGCGCCCTGCGC
ACCGACGAGGTCAAGATGTTCGTGCTGGATGAGGCCGATGAGATGCTGTCCCGCGGTTTCAAGGACCAGATCTACGAGGTCTTCCGCTTCCTCCCCGAGA
AGGTGCAGGTGGCTCTGTTCTCGGCTACCATGCCGCTGGACGTGCTGGAAGTGACCCACCGCTTCATGCGCGAGCCCATCCGCATCCTTGTGAAGCGCGA
CGAGCTGACCCTTGAAGGTATCAAGCAGTTTTTCATCGCCATCGACCGCGAGGAGTGGAAGTTCGACACGCTCTGCGATCTGTACGAGACGCTGACCATC
ACACAGGCCATCATCTACTGCAACACGCGCCGAAAAGTGGACTGGCTCACGGAGAAGATGCAGTCGAAGGACTTCACGGTCTCGGCCATGCACGGCGACA
TGGAGCAGCGTGAGCGCGACATCATTATGCGTGAGTTCCGTTCGGGCTCGTCGCGTGTGCTGATCACCACGGACCTGCTGGCTCGTGGTATCGACGTGCA
GCAGGTGTCGCTGGTCATCAACTACGACCTGCCCACGAACCGCGAGAACTACATCCACCGTATCGGTCGTTCGGGCCGTTTCGGCCGTAAGGGTGTGGCC
ATCA