Description :
From Genome Similarity Track
Location :
contig_4:913238- 914549
Transcript NameFunction/comments
g1249.t1hypothetical protein PHYSODRAFT_520613

Sequence
1311 bases(100 bases per row)
GCTGCAGCCGTTCCAGAGCGGTTGGTCCACCTCGCAGATGAACCTGTCGCAGTACAACGACACGGACGAGTGCAATGCTCGCCCCGTGGCCGAGGACACG
TGCCTCATGTTCCCTGGCCACAGCAAGACGGAGTGGACGTTCGCCGTGAACGCATGGATCTTCGGTGCCATGGTCGGCTCGCTGTGCTGCGGCTACTTCA
GCGACAAGTACGGCCGCAAGAAGGCCCTCATGGGCAACTGCATCTTCATGATCGTGGGCGGCGTCGTGCAGGCGGCCGTGTCGAACGTTTGGCTCTTCGC
CCTGGGCCGTCTCATCGCCGGTCTGTCGTCGGGTACGGCCACGGCCACCATCGGCGGCTACATCAACGAGCTGTCTCCGCCGCACCTGCGCAACACGCTC
GGCCTGGGCCTGCAGATCTTCACGACGATCGGCATTTTGGTGCCGGCCATCACGTTCTTCTTCGCCAACACGAGCTCTGGCTGGCGTTACCTGGCCGCGT
TCCCGGTGGTGCTGGCTGCCATCTACCTGCTGCTGGCGCCGTCCATGTGCGTGGAGAGCCCTGCGTGGCTGCTGACCCAGGGTCGCCGTGACGAGGCCAA
GCAGGTGATCGCTCGCCTGTACGGCGAGGAGCACGTGCAGACGGCTCTGTCGTGGCTGGAGGTGAGCAAGAAGGGAGACCGCGGAGGAGGGTCTGGCTGC
TCCCAAGAAGGAGTCGATGTTCGCGCCTCGCTACCGCCTGCAGCTTCTCGGCGGCATCATGCTGTCGATGGCGCAGCAGCTGTCGGGTATCAACGCCGTG
TTCTACTACTCTGGCAGCATCTTCTCGGACGCCGGCATCTCGGACTCGCGCGTGGGCACGCTGATCATCGACTTCATCAACATCTGGCCCGCCTTCTTCA
CGGGCGTGCTGGCCAACCGCTTCGGTGCGCGCAACATGATCCTGTGGGGCCTGTCGGGGATGGTGGTCATGTCCATCGGCATGACGGTGGCGTTCATCGT
GGACGTGTCCGCTCTGTCGATTGTGTTCACGGCGCTGTACGTGATCGTGTTCGGCGTGACGCTGGGCCCGCTCGTGTGGGTGATGACGGCCGACATTTTC
CCGGACTCGATCCGTGCCAGCGCGTCGTCGCTGTGCATCGGCATCAACTGGCTGTGCAACCTCATCGTGGGTGTGTCGTACCCGTACATTTCGGACGCTC
TGAACGACTACGCGTACGTTCCGTTCGTGGTGCTGCTGGCGATCTTCTACCTGCTTGCTCTGAAGCTGGTGCCGGAGACGTCGGGCAAGTCGGCCGAGGA
GATCCAGGCCG