Description :
From Genome Similarity Track
Location :
Scaffold_2:91323- 96310
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2-snap-gene-0.71Ras-specific guanine nucleotide-releasing factor

Sequence
4987 bases(100 bases per row)
CGAGCGATCTCGACTGAAAGTATCCAATTGAATCGCCTCCTGTAAGAAAAGTTTGGCATCTGACTTTGGATTCGGCATCCGCTGTCACTGACCATCTTTT
TTTGCACGACCTTGCTTTTCTCGACGTGATATAGGGATGACTACATGCTCGGTACAAAGGGAGATCGGATTATGGAGCAGATGGAGGAGCTGATCTCCGA
CGAATTTGCTGATACAACAGCGAAGTGCTCAGGTCCAGCTGAGAAGCAGCCCAGCTTCGTATCGACCGATCTGTTTGGGGACGAGGTGAGATCTTTCCTT
GCTTTCTTCACGAACGTGAGCTCTTGGGAACCTTCTTAATCACTCAATGTGTTTTAGGAGTCCGATCCGAGCGTGGATGCACTGAAATCGATGGCGGATT
TTGAGAAGTACATTTCAGAGAACTGAAGCGCTTGCTGCATCTAAAGGAGGTTATGTCAAAACTAAACACTTTTCGCTTAAATATTTCTGCATACTCTCAT
CAACAAAACTGATCGGCGCTTCTAAACCCATTCGTGCTGGGCAACTTGAGCAGAAGAACGGGAGCGATTCCGGTGAACGACTTTTTGCTTCCGAATCCAT
TGACGGATGCCAAAAGTTCCCTCTGCACCAATTGACTCCCGGACTTCACTTTCGATGTCGAGGTCTTCGACTGTCAATGACGATCGGTCACTTAATGGAG
CAGCTCCAGCCTCGCGGGGCTCCAACGCAAGGGAGCGAGCGTAGCGACTCTCCTCAGAGTCGTAAGGAAGGGATACATGGAGCAATTTCTGCACAGCAAA
AGAAAACTGTCAGTCGCAAAACACCTTGAAATGTAAAAACACAACGCGCCATTCATAACTCACATCGGTATCTTCATCAAATGTGAGCGCATACGGAACG
GATCGACGGCGCAGAATCTCCATCACCAATTCACCCAATTTCCGGAGTCGGTTTGCGTTCACCATACCCGGTTTTTCGAATGCAGGGAGCTCGTTGATTC
CCACGAAGCTCTGGAGATAGAGTCCGATGTACGGCATGCTTGGGCTGGAGGCTTTCCGCATGATCTTGTTCATCTCCCGACACCCTTTATCTGAAAGAAA
CTGCATCTCATTGAGCAGCTTCGTCGATGAAACGCTTAGCTGCAATCAATAAAAAAACAGCATTGCCGTTAGCAAGAGAACTAGCTGGTAAACTAAGCAT
AAGTACTTGGAACACAAAGCACCAACCTGGTCGATTGTACGTCGGAGACGCTGGACTGCAGTCGACTGCAATGCGTACAAAATTGCGGCGAGGGTGTCGT
AGTTCTGCAACGACAAGCTATATTCCGCGGCCTATATCAATATTCACCAGATACAGTGAGTTGCTTTGTTAGATGTGTAGACGAAAAGTCGATCTACAGT
GGCAACTCGGGCTTACTGAAAGGAAGAATGCGATCACTTCTGCTCGTTCTCGAGAAGACTCTTGGAGAAGAACAGCATTGATCACATACGCGGACAGCTA
CAAAAGAGATAGTTGGGTCAGTGAGCTCCTCAATTATAACTTCAGTGAATGTGATACACGTTGTCACTTACATGCTGGAACCATCGTCTCGCGCAAAGGA
ACTGGGAACTGTAGCTTTGCTTTGAAGTCTTGATGAAATCTTCGACTTTGTGTACCAAAAAAAGTTGTGAGTTGTGAGTTTGCAATCCAGGTAACAGAAG
AGCCTCGGAGTGAAATATGCTTACCTGGAATACTGGAGAAAAGTGCGTGTGTCAAAAGCGTACATTGCTCCGCCCATTTGGATGGCTCAGTGTGGCTGCT
CGGCAAAATGATAAATTTGAGTCGTCAATCCCCGTAAAGCAAAGCAAAACACACACACACACAATTTCTTACCGGTGCAGTTTTGCTGGAAAAGATTCCT
TGAAGCCGTGAGTGTACGGATTGTACATATCTTCCATCGCCAACGACGCCTCGTTGTACTGCGTCAAGCAACGCTCACTGCCCTGGAGGGCGAAGTACTC
GTGAAACAGACCCTTGCACTCTTGGACTATCGTCGTGAGTCTCTCTTTGTCCACACCAGTGAATTGCTGCATCAAGGAATAAAACCGCTCGTGGACGTAC
TCCAAATCAGCGACGCTGTGCTCCTTGAAAAGAAGGAGCATCACGAATAGCCGAATGAGACCGCGACCTGCATAACACGAAAAACCAACATAAAAATCTT
GTCACCAACTGCAAACATCAAAACGCAGCGCGCTCCATCCATGCAAAACGCACCTTTTTCCTTGCTCCAGGTTTGCGCTCTCAGGCGCTCCACGACTTCG
TTCAGGCTTGAGAAACTCTCCAGAAACATGACAAACGACACGATGTCCGCGAAGTCTACCGTGACGTCATGAACAAGACTGTTCACGAGGTCGTCAACGC
GATACGATCGAGACGTCAGAGAACTGCCGCCACTCCTTCCATCCGACACGTTCCACGAATCTTGAGGCTTCTGCAATATCAAGAATGACATGTCCCTGTC
AGCTGCATTGCTGTGGAGACCGTAGTCCTTGGCAGAGCATCCGTAGATATCAATGTCTTCGTCACGCGCCATGCTTAGTGAGCCCATCTTTCGAACAAGC
CGCATCATTCTTTCGTCAGCCAGACGACTCGCTAAATGGAAAACTTGACGGCCAAACATATCTCGCTTGTCGAGACGACACCCAGAGCAGGTCAAAATCT
CGAGACACAGTAGAACGCGATCTCTTGGAACCTGACCTGACGGTGCGGCTAGTAAGATAGTGGCGGCTGTCTGTCCGTAGCGATTCTGGATGTTCGGATC
AGCACCAGCGTCGATAAGCCGCAGAATGATCTCCGAGTCACCATTCGCCGCTGCCAAATGAAGACTTGTGTCGCCTTCAAACGTCTGGATATTCGGGTCG
GACCCTTTCGAGAGGCACAAATCCACCAGCTTCAGATCTCGCGACGAAACGCAGAAATCCAATGGAGTGAACCCGTTCGACCACGCCACCTTGTGGATAT
CTGCTCCAAGCGCCAAGAATGTCGCAGCACCTTCCATGGAGCCTCTAGAGCACATCCACATCAACGGAGTGAACCCCTTCTTGTCTGGCGCGTCGATTTC
CGCCCCCGCGTTCACCAGTGCTTCGATGATGATCGCCATATCCATGTTCTGCGCGACGACATGTAAAGGATTTTGTCCTTTACGGTTCAAGACATTGGGA
TCTGCTCGTAGCCCTAGCAAGTACTTGATCATTGCACCTTGCCCGTGGAACGCAGCAGCAAAGAGCGGAGCGCTTTTTCCAGAAGGCGGCTTGAAGCCAA
ACACCTGCTTTCCGCGAGCTTTTCCCCACGAGCATAGCACGTTTATATCCACTTGGCATCCGAACAGCCACGCTGCCGAGTCTTTATCACCGCGCGCCGC
AGCAAGACACATCAGGTACTGGAACATTTCGGCATCGAGCGACAGCACTTGGTAGTAGTAGAACTCGGTCATGAACGTCAGGCGCTTTGGGAGCGCCGCA
GAACGCAATCGCTGACAAATTTCTCGAAACGGCATCAGCATCACTGGCTCGTCATTGATTGCGATCAGCGAGAGTCCCGGAATAATCGCCTCACTCAACG
CAGCTTGGGAGAGTTTGCGAATGCTATGCACAACCGCGCCGCGACCGTTTCCATCTGTCGTGAATTGGATGCCGATTTCTTTCGTGGAGATAGACACTGT
GATTCGCGACGCCGCGAGAGACATCCCGTCTGATTGCGGTCCGTATTCGTTGCTCTCGTAGCACTCGATCCACTTGATCGCATCTAGGAACGACTCAACG
ATGCTTACGGTGTTTTGGCATGCTGGGTGGTGCTTGTAGACGACCGTCAGTAGTGCGCGGAGGATGCAGACATCGTCGGCCGATGAGAGCACCAACACAT
AGCGAAAAATAGTGGAAAGCGTCTCGTCAGAGACGTCAAAGAGTGCGCCGTGGTACCGAGCGATGGTGTCGAGAATTTCCATCCCTGCAGCAATGACGAC
TTCGATCTTGTGGCTCGGCAACGAGACGCAGTCCAACGAGTTCACGATGTCTGCTACGTGTCTCCAATCGGAGACTGCTGATAAATCACCAGGGATGCCA
AACTCCGCTTGGGGCTTCGCATACAGAAGTTTCATGTTTCGCATCGCCTTGTTCCGTGTTGCGCGCAACTGCGGCGTCTCCAGACTATCGTACACGGCGC
TGTAGAGACCAATAAATACGCGGTCTTCAACTTGTCGGCGAATCAGCTTGAGCAGCTCGTTGCCCGGCAGCATCTCGATCTCGTTATCTGTGTACAGTGC
CAAGTGATGTTTGTCGATGATCGTGTCATCGAGCAGCTCGATGAAAATCTGGATATCTTCTGCGCGATGGATAGCAGGGGTGTTCTTGAAGTCTTCAACG
CTCTGTGCGATCTGCTTGTCGGTCACGAAGATCTTATTCAGCTGGCGCGTGACTGCACTCGCTCCCGCTTTCTCTTCCGGGGCGGTCAAATCGATTTCAA
AGCACGTCGGCGGTGTTTTCCGAGCGGATCGAAGCGCAGAGACCCACAGCTCTGCTTCAAGCTGGCTGCAACAGTAGCAGATAAGCTTGTAGAAGCCTTT
TTCGACCTGGAACACGTACGGCTTGCCGATTTTCCGGACGTCGACGTGCTTGACCGTGACGATGCCGTCGTTGAGCATCAGGCACCCTTGCATCTTCTTC
TTGCCCTTGTTCTTGTAATATGCGAACGTTCCGTCCGCGTAGAGCACGAAAAATCGCGTCTTCCACGTTTTCCTGAACAAACAACCCATTCGCATAACGA
CATTAGCCCATGTCCACGCTTAGAGAGAGAGAAATCATCCCATTTTGTCTGCTATGCTAAAAACCAGAGTGTTCACGTACCACATGTGGCCCTGCTTGGT
AAGCCAGCCCATTTTGATGAAATTTCCCAGCTTGAGCTGGGTTGCGTAGTAGTCGTCGTTCACGAGCGGATCGGAGCCACGACGCAC