Description :
From Genome Similarity Track
Location :
Scaffold_171:91321- 93265
Transcript NameFunction/comments
Phyci_16385Hypothetical protein

Sequence
1944 bases(100 bases per row)
aagtgacgcacactcgctccgggtctggcaccccggccagcttagacttcgagtacgcagtgtctagagcccaggctagttctccatctggccgcaatgg
gcatacttcagcgtcgacagaaacgtgctagccatattcgataccacgagtcggcgaactcggtcgttgtctaccgggtccacgatcccagagatgtaat
tgctgacaagatttgggcttacgtgacgaaagaaaccacagatcgacaagttggcgcggacacggtttggtaagctgtgcgcttgcgggaaatttaccga
gtgtagtacgtggaatcccacgcattccccatcgaaagtctcggtggtgccagtagcctcaacgtagacacagtcgcgattctgaactagtccagtggac
tggaagagaatatcgagctccatccatttgatcacaaccgaccgaaacggggcctcctccgttggcatcacaaggttcgagagcaccgccaccgcattca
gatcgtcataggccttgatgcgcatgctctccacggtggggttgacaacaccgaacatcacatcgtctagTGTCCCAACTGTAGTTCCGACGGTGGGTAG
TGATGAAAGCTCGGCAACAGAAGCATCGAGCGATTGGGAGCGCGGAGATGGTCGCTGGTTTTGGTGTTGCTCAACAAAGACGTGTGCGTTTTCTTTGGAC
TTGACGGCCTTCCACTTCGTCGTATCAACTTTCGTTTTCTCCACAAACGTAAAGTTCTCGTACCTCTGCAAGCCAGTGTCGACGATCGTGTTGACGATGT
CAAGAATGTTATTGGCATCAAAGGCTGAGAGCTCCAATCCCGGAAAAGGATTCGCTGTGAATCTATCCTTCGCCACCCGTGAGCTTCAGCAATGTAGGAT
TATACTATTCAGCCTCTGCGGCTAAATGGGAAGTGATTGCGCTGCCGTCAGAGCAGTATGTCTTGTTCTGAACATCCAATCCTGCCATCATCTGTGTTTG
AGGGGACGCAATGGTACACACGTTCTCAGTATGCATATTGAGGCTAATGTACGGCTCTCACCCACCGTAGAAGCTCCATGTGCTTTCGCAACCAATAATT
TTCTGCATCTGCTTTATTATTCTAACCCACAATCTAGTCGCCTGACAAATAAGCACCACATGGAGCCTTCAACGCGAACGTGGGGTTACTGGCACAAGCT
GTGAAAGTGGATTTTGTTGCATAATTTTTAAGTATTCGTATCCGCATCAAGTGCATGTATCATTATGAAAAGTAGTCTAACTATTCGGTTTACTAGAGCA
GAATCATCTTGAAATCAGTGCAGCAAGAAACATTTATGATAAGTATCAACTGATATGTACAAAATTGCGAATGGTAATGTAATATTACAGTCAAATGTAT
ATGCGTGAGCCAATCACAACTCATACATATTTAAGGTTCTAGGTGTTTTAATGTTCTTTATTAAAGCAGATATCTGTAACATAATACACTTCGCGAAATT
CATTCAATACACTTCGTTCACCCTATCACGACAAACGTACAATTAGAACAACGACACGATTATCACCTTTCCTGGCCACTTTATTTATATACAATGCTGG
ACGCACTCGTTGGGTCCAATTTTTTGCTTTGGTATCGCACATTCGATAAGAGAGACCTTTGTCGAGCAAGCACAGCAATAGGCAGTACGCGTATACGCCC
AGTAACATTCACCACACCACAAGTAGGAAATCATCTTCACTGTGGAGACGACTTCAGAACCAGTGGGATGCGTCAGGATCAGTGGAGCGATTGGAATGTT
TGGATCATTATTGCAAGACTGTATCTCGGACCCGAGCAATTTTGGTTTGCGTACTCACTTCAGCTCCTGTCACAGATATTACAATTGGGCTCGAGTGTCT
GCCGCTTCGGCTTCTGTCTGAAGGCTGGATAGCGCCTTTCGGAG