Description :
From Genome Similarity Track
Location :
Scaffold_509:9130- 10568
Transcript NameFunction/comments
Phymu_g10463hypothetical protein

Sequence
1438 bases(100 bases per row)
ACGAGATGAAGCAATTGCGGCAACAAgtgcagcaattgcagcagcgcgagcaggAGCTTATGCAAGCATTGGTACGTATGCTGCTCCCATTATCCTTGTT
TCGCTTGCGTTTAATTCGAACTTTGTGCAGTCTCGCCGAAGTCGCAGACAGCGTGAATCGCAGGAATCTGGCGAATCTGCAAGGCAGTACTTTTAAATAT
CACCATAATTTGACGTAGGTAATTCATGTTTTTCTAGCATGCCACACAAAAACTGTCCAAAAAGATTCAGAAATCGTAAAAACTCTAAATTTATGAAATA
AACTAAAACTAAATTTCTACTTCGCAAAGTCTCAGCTGGCAGCCAGGCAGGCAGGCGCGACCATGAGCGAGAAGTCCACAgtggcgttgctgaagaagag
tcTGCCGTGGCTCAAGCGGCTGCAAGGCGAcctggatgacgacgactcgTCGGACTCCTGCTCACTGCCGACGGATGTGACACCCAAGAAGGCTCCGAGG
GCGAAGCCAGTTAAGAAGGAGGAGCCCAAGACTAGACGCATTAAGAAGAGGCCGCAACTGCTGAAGAGTGAGAGCAGTGATGACGCTTCGTCAGAAGGAA
GTGACGATAAAAAGCTGCCAGAGCAGAGACCCGTGAAGAAACCAGTGAAGGCAAGACGAAAGCAGCCTAAAAGTGAAGGATCTACGGTGGTGGAGTCGTC
TGTAGCTACAGACGCAACTACCAGGTCTTTGAATGTGAAGCGGGTGGGGAAGATGCGTGCAGGACAAGTGGCCAATGACCACAGCGAGAAGACCTCCGCC
ATAAAGATCAAGCGACAGCAGCCAGCCAAGGGTTTAAACGCCACTAGGAATCGTATGCGAGAGAGCCGAGCTGCACAGAAGGCCTCCGCCGCTGTGGATG
CTGATGTGGAGGACGAGGGAGAGCCCCGGCGACAACGAAAGGTACGACCGACATCTACTGAGGATACGACACCCAAGGCGACAAAGCGTAGACGCAAAGT
TGCAacttcgacagcagcgaacgACAAAACGGAGCCAGTGGACTCTCCTTCTCGGGTTATTGATAAAGATTCGGATGCAAAACCTGGTGTAAAGAGTGAC
GTGGTGCCCGCAGTAGTGACGAAGGATGTGACTGCTGTTTCGGAAAGCCACGAAGGTGAGAAAAAGAAAGTGGACTCTTCTGGAAGAGCCGAGGTCAAAG
ACAAAGAAGAATCTTCGGTAGCCACAAGAAACGCGCCTTCTGAAGCTGTCAAGTCCGAATATGACACAAATCCATCCGTAGTCACTAACGAGCCATCGTC
TGATGTGGTTGTATCGGAGACCAGCGTGAAAATTGATGGGAAAAAATCACAAGACAAGTCCGAAAACACAGGAGAATCAAGCGGAATGTCGGAACTGGCT
ACGATCGACAACGCTGAACCTGCAGAACTGGTAAAGGC