Description :
From Genome Similarity Track
Location :
Scaffold_357:913- 3908
Sequence
2995 bases(100 bases per row)
GCGTCACCTGCAAAATGGAAAAACAATGCCGTTAGTGGTCCACAGTCATAGCTAGAGCGGTTGCACTAAACGTACCTCGAGAATGCGCTGCAGCACTGCC
ATCAGCAAGACCAGCACCGAAGTAGACGAGGACGAAGCCATCGACGACTTGCCGAAAGCTGGCTGCGGACTGGTCCCACACTTTGCAAACTGGATGCTGA
TCCACTCGATCGCCGCAGCCTTCGTCACGAGGTGGACGCTGCCAGTCTCAGTGGCGACGACCGCGAGCAGGATCTGGAGAACCAGCGCCTGAGTGTGCTC
GTCCGCGAGGTCGGACGCGAAGAAGCTCATGAGGATCGACAGCACGTGGCGACGCACGAGCAGCAGTACGTCCGAGTCTTCACACACGCCGCGTCGGAGT
GTGTGCAGCAGCCACGAGCGCTCCTGCTTGTAGGTGAGCGGCGCGCGGCTGTTGAAGAGCGAGTAGAACATCGGCACGTCGCTCAGGTCAAGCGCGGGAC
GCGCGAGCAGGAAGTGGTTCACGTGCGGGTACAACGTGTGCGCGGGGCGACACAGCACCGAGACGGCGTCGTTCAGGAACACGGTGACGACCGACGGAGC
GGGCTCCAGTGGCTCCGCTATCGCGCTGCGGAACACATCCAGCAGCAAGTGGATCTGACGACCGGCCTTGAACTCGGACGATGATGCATCTGTGGCCGCC
AAACTCTCGTGCATGTGTGCGAGGATGCCGAACGCATAGCTGCGGATGTGCTCGTCATTCGATGATGTCGCGCGGAGAGCAACGCCAAGCAGCCCTTGCT
GGACGAAGGCGTCGTTCGGGAGATCCGAGGCAGCCATGAAGTGGGACAGCATCGGGAGCAGGTACGCTGGGTCGTACGCGAGCTGCACTCCATGCTCGAG
GTGTTGCTGCGCGTGCTTCGTCCATCTAGCTCCATCGATGCCAACGTGATTGCCGTCATCGTCACTGGCGTCTCCTAAAACACTCTGCCAACTGAGCAAG
GACTGGTCGCTCGATGAAGCTCCGTTCCGATCAAGCGGGAAGTTCTCAACAGTAGCACGCACGCGGCCCTGGTCAAGCCCTCCATTCACGATCCACAGCA
CATCCTCGACCAAATCCGATCGAGACACCGCTGATGGAGCAACCGCCGATGACGAGGCCGATGCGCCAAAGCGGAAGCCCACCCTCACTAGCGAAAGGTC
CGCGGAGTGCTGCTCCATGTGCGCCAGAAGAGCGCGGAGACACCGATCAGCCGTCGACAGCGACATGGTGTATGCACCGAGGAGCGTCTGGAACAGGGCT
GCCTGGTAGCTATCAGCGCGATCCACCAGACCCGCAACCACGCGCACCAGCAACACTCTCACAGTCTCGTTCTCGTGATCCGACAAGTAGGCACTGAAGC
TACCATGAGTGGTAATGGCAGCCAAATGCGCCGCGAAGTCGTAAACTTGACTGGGTTCCGCATCCGCAGGAGCTGCTGCCACTAGACGCAGAAGAACGGC
TGACAACTCCACAAAGCTCCGGAAAGCGACGGCGTCACTATTTGTCTTGACGAAAGCCACCACATCGCGGAACTGCGCGAGCGACTTGGTCAGCGTGATA
GAAGCATCGAAGCCATGGCTCGCCAACAGCTCGTCCGTAATGAGACGAACTGCAGTGCAGACTTGAAGAGCGACAGAGCTCGACTTCGTGAGTGCTACCA
CGCCACATCGAATCAAAAACACCACCAGATTGACAACACTCGAGCTGTGTGAAGCACGGAAGCCTGACTTCACCAGCAAAAGGACGCACGTGATCTGGTC
GCGCGTCAGGTCAGCACCACTCGGGTACTTCGCCACCAATCGCTTGCAGATTCCGTCGAACAGTTCTGCGGACACCAACTCATCGTCACGACTCGAAGCG
ATCAAATGTCGAAGCAACGACAAGCGGATACGGTCGATCTGTCCTCCCTTGTGCTGCGTCAGAATCGATTCGAAGCAGTCCGCAACCAACGAGCGCGCGA
ACGACTGCAATTGCACGGTTCGAACGTGACCAAACACGTCAAAGCAAGCGTTCACGAGCATGTACGAGACTGGTTTGTGTGCCGGCTGCTGCAGCTGCGC
CAGCAAGACAGTCTCCAACTTGTCCAAAAACACCCCACCATCGTCGGAAATGACAGCCACAACACGCTGCGGAATCAGTGGTGTGAGCGAGCGATCCTGG
TCGAGAAGGGAGGCAGCTTCTTCGAGGACAGCCGGCACGATCGTGGCTTCGATGGCTTGCTCAAATACGTCACTGGTAACGCCGCCCATCATTCGAAGCA
GCTGAAGACCAGCAACAAAAACGTCGAGAGATTGACGACGGTGTTTCTTGCCACCGTTCATCCTGGTCTCCAAGAACTGCCACAGACGATTGCGAACGTG
GCTTGAACGGACCAGCGACTGGCTCGGACTAGCGTCGTCTTGGCATAAATACTGAATCGTGTGTTCAATCAGCGCGCGACGGACTGGCTTCGAGAACGTA
TTCACCGAACAACGCAAGAGGTGCTCCAGCACGGCAAGCCGAACAGTACCACGCTCGTCCGATACGGCGCGAAGGACGAGCAGCGGCACCATCGCGGATC
GGACCAGCGCTGGAGACCAACGTGCACTGGCGAACTCACGATCGCCATCAAGAGACATGGATTGCTTGATGACGGTCACTTGGATGGCGGTCAATCGGTA
CCGCAGAAATGACGCGTTGTTCTTTGAGTCTGGAGCAAGCTGCTGAGCCAGTGCATGCAACTTGGCTACGCGCTTCTGTACTGCCATCGATGAAGCACCG
CTCGACGCGACAATAAACGTCAGCAGCACAAGCAGGAGGTTGAACAAAGGCAGGATCTCTTTCTCGGATACTTGATCGTAATGACGCGCGAAGAAGAACA
GCAGCTGGTCAGACATTTGCGCAGCGTCAGAACCATCCAGCAGCGACTCGTGATCCTTCTGCGTCACCAGCTCGACAATGCTCGAGGTGCATGAA