Description :
From Genome Similarity Track
Location :
Scaffold_240:913- 3036
Transcript NameFunction/comments
Phyta_totarag6044hypothetical protein

Sequence
2123 bases(100 bases per row)
CAGTGACGATGGCATCTGCGTTTGCCATGAGTCCTATCCAGCATCCAGGAGCCAAATTCGCACGAATGGACCCGATTGACCCACGAGCGATGggtgcagc
acgaagacgacgaaaagAGACTGTGAACGAGAAAGTGGAGCACATTCTGCGAGGAGCATTGCGcgacgccgaagaagacgcgtTGCAGGAGCGTGAAGGT
GGCCCTGAAACGCGTGGACGGGCATTGCAGCGCTCACGGCAACTGTCATCCTTGTACACAACTTCGACAGAAAGCAAGTTCCTGCGCTCTCGAGCGAAAC
GAGATGCGTCAATCCAGCTCGGTAAAGAGACGAAGGCCAAAGGAGACTCCGAGTCGTCGATGACACGTGTGAAATCAAGAGCAGGGTCGGATTGCGTAGT
GAGGGCGATCGGGGAAGGCAACGAGAGtgacgagagcgacgacgacacatTTTCAGTGGGGCGGTTGGTGCTAGCGTCTCCCATTAAGCCAAGTGTAAGC
TTACCATCTCAATCCCCGgttccgacgacgacgacgtcaccTGTGAAACTAATCAAGCCATGGTACAGATGCAGCCCCACAGCAACTTTGAAGGAGCAGA
TACCACCAGGAATTACTCTAGATGCGAAGTTGCGTCGCTATGGAGCTCGAGGCACGGCGAAACTTCTTCACGGTTGTAGGTCTCAAGAGGCTCTTGAACC
ACTTTCTCCGAATCACCCGCTGGTTCCTGTTGACGAGTTTGTGCCGGGGATTAGCGGGTCACCTTCGCTTTGGCGGCCAGAAACTTTTCACCCGACTGGT
TCTCGTCTGCAGGTTACGATGACACGTTGTCCCTCGTCTCCTATCGCTGTTTCTGTCGATGTTTCTAGCTCAAATGATGACCACAACAGCTCGAATCACT
TCGACCACTGCCATTCATTTGCCGACACGCGGGAGACtttgcagcagaagacaaCGGAGAAACTTCATCGTGCCTATAAACGAGAAGTGAAGGTGGCAAA
GGAGGAGCGCATGCAAAATCAGCGAGATCTCTCCGAGTGGCAGAACCGCACACTGCATTTTGAACCTTCATCTGAGCTGGCTGCTCATCGAGAGCAACAG
AAGAGCGATCCACAGCTTCGCCATCGACAAACTCAAAGCTCAGCAATAGTCCAGACACCAGGTTATTCTCCtgagaagcagcgcagcagcgagtcgagCG
AGTTAAGGAAGAAGAGGTTCAAGCTTCGCTGGCAGTCGTTTTCGAGGCTTCTGGACGCCATGCGACGCACACCATGTAGACGGCCGGTGCTCCAAGATAT
GGAGAAGTTGTTCGCACTGGCTAGAGAACTGGGCGCACTCAATGCACTTGGTGCTTGTCTGCTCTCTCGCTCTCAATTCACACAGCTTGTCACGAAAGAG
TTCCCGTTGTGCGATCTCAAGTATGTGAACCGCTTGTTCTCGTCGTATGACTGGGAGATCCGTGACTCTGTAGATGCCCGCATCATCCTTGGCACTATGC
GGGCAATGCGCGTTCAACAAGGCGAACCTGTGGAGCTCATCTGCGCTTCACTATGGGACTTTGATGGTACAACCGATACGAACAGCAAAATTGTGAATGA
CAACAAGACTGTGGTCTCGGACGGGGTTTGTCTGACTAAAGCACTTTCGTTGTGCTGTGTtagcgacgatgaggagaaggaaaTGGAGTCGAGAGCCGAC
GCTGTTTGGACGAAGACTCTCTCTTGGCAACGTCAGATTCTTTCGCGCCGTCTGCATGGGGGTATTCGACACAACGTGTGGAAACGAAACCCAGGAAGTA
TTGCGAGCAGCAGTGCGGTGGCACGTGTAGCAGACTCCGATAGCTatggaggagacgacgacgtagTGAGCAGAAAGAATGGCGAAGATGGACAGGGGAA
CGGTAATGACGATGACgccgacgatgaagaggacaGTAATGAGGAAGTACCCGAACTTATTCGGCTGGTCGATGAATCTCGTGTGCCCGTGCGGCGTATA
CGTGAGGCTCTCAAGCGCGAACGAGAGACACTGGCGCTCTTCACGCAGCAACtactgcagcgtcgacacgaATGCTTGGTTGGCGCCAGTACGCCCTCTC
CTAGGAGgtgactacatgtagtt