Description :
From Genome Similarity Track
Location :
Scaffold_94:91299- 95769
Transcript NameFunction/comments
Physo_141106putative guanidinoacetate N-methyltransferase
Physo_141107hypothetical protein

Sequence
4470 bases(100 bases per row)
GTTGCAGTTTCGTACTTCTTGAGACGGGTAAAAACATCGGCAGACCGTCTCAAAAATATCATGCACGTCGCGATTTAGCGTTTGGATCAGAGCGAATGAA
TCTACGATTCATTTTACGCCATCGTAAGTGGCCAGAAGCTTCGAACTGCTGGTCTGACAGTAATTTCTAGACCGCCTCCGACCCCTTCGTGCAATATGAG
GTGATCCGCAATGGTGTACAGTACTGTATCTATCATAGCATTGCCTTTAGCGCTGCCGAAGTCCCGCTCGAGCGGACGGTAGCGCACGACATCATCATAC
AGTGTACAACTACAAGATTCCTTGGTGGGCCACGAATCGTGGTGCTCCTTCAAGGACCCCTTGCCCAAACGAGCTCCCGCGCGAAAATACGTTCAGGACA
GGTCACCCAGACTTTTGTTTGGACGCAGCAGCCCTGCTTCTTAGCGCGCTCAAAAACTCTCGTCGCGATTGCTCATCGGTGTAGTGGCTTGCCCTCCTGC
TGTTTTTGCCATCTTCGTATAGAGCGTGGTCCGCTGAAGCTGCTTCATCCTCCACGACACTACCGCCGCCACCGTCGTCGTCTTCGTCTCCAAAGCTGTC
CGATTGTTTGTGCGAAAGTGCATCCATTTCGTGAGCTAGAAGGAAATCTCGGATCTCAGCAATCTGCCCGCGCTCTCGTGGAAAATTTGTCGGTTGCGGT
AGTCCGGGCCTGCTCGCACTCTCGAACGCACGCTTGAACTTCTTAGACGGGCGAGGCAAGAATGCCAGTGAATCGGCCCCAGCGCCAGCCCCACTCGCAG
CAACCAAGGAATCTTCAACGGTGATCACCGGAACGAGAGCAGTCTTGTGCGGGAAATAGTTGCAATTCGCAGAAACGCCGACAAGCACCTCGGATACTGC
TACACAGCATCCTGAACGCTGGAGATCCATCTCTCGAGCCAAATACCCGGACACCCTAGCTCCATTCGCACAGTGTTTCAATGCGACATCAAGGAAATCG
TGCCAGCGCGACCTAGGTACCCACAATTAAAATACAAAACCCCTTAGCGTGACACAGTTCCCTTTCTACCTAACTACCACTCGAGCAACTCACCGTCGCC
CACCGTCTCCTCCCTCTCTTGTAGGGAACTCCCCGGATTCCAGCTCCGGAAGCGGGTAGTCGTCGAAGAAGACGCAGTCGAATTGGTTCAGCGTCGGCAA
CTGCTGCTGCCACGTACCGGCCACAATCTCCACCCCAGTGTGAGCTGCTGCAAACAGCCGGGCACGTTGCAGCGTCTCCCGATCGCACTCTATGATCGTG
TGGCTCCTGGGACGGAATGTCTGGATGCGAGACGCCGAGTAGGCCAGACCGAAGCCGATCTCCAGCACGCGGTCCGACGGCTGGATGGCGAGCGCGTCCA
CGCATAGCTCCATGTACTTCTTCTCCCACTGCATCATCACCTGCTGCCCCCGCGAGCTCCAGAGTACTTCCTGCCCCAGCTCGTCAAGCCCATGGACGTT
GCCTTCGGTTGTCATATTTGCAATTTATGTTTGTAGACCAAAACTCATTTTTCACAAACTATTGGTCGCGCACATTTCTTTATGATACAAAATACTCAGT
TTGAAACAAATACATAGACTATGCATTATATATATATATATTGTATTAAATATAAATATTGATTTTGTTTTCCCAAGAAATTTGTCCTAAACCTTTCGCA
AAAACTGCCGCCTTCATATTTTTGAGTCAAGGTGATGGGAGCGACTTCATTTCGCTAGTAGAGGTCGGAGACGTCCTGTTCAGTCGTCATCACTACAACT
TACAAACCGTTTAGGCAATGTAACTATCCTACGAAAGATAAAATCTGGATGGTCTCTGCCGGCCTCGTGCGGAGATACCGGTACATCCATTGAACTCGAA
TCCATCACCGAAATCGACAGCACTTCTAGCATTTATGTAGCACTTTATCTTCTACGTGCTTTATAGCATAGTTTACATTTCCTGCTCGCTACTGAGCTAT
CAGTTTGAACCACAACATGGAAGTTCTTACTTAACCTAACTAACATTCAGCATCGCAGTGAGCTGCAAGCTGCCCTGAGTTGATCGAGGCATCCATAGCA
GCAGTGAGCCGCCACCTGTGCCTGGAAGGCCCAGGAATCCGGGCCTCCACCGATCCAAGTACAGCGTCTTGCCTCCCAAAGCAGTCACATTCGACCTCCA
CGTCGCCGTTTTACCGGCCGGGACGTCCACTTCGTCGATCTTGTCACCGCCAGACTTGATATTCACCGTCACGTCTTCGGTATCGACACTCTTAAACGTG
ATCGTAACGCTGCCATCGCCAACTTTCGTCCACAAGCCCTCGCTCTTGTTGAAAGCACGCTGAACGGTGGTCAGGCCCAGCGCCTTGCTCGCTGGTCCGT
CGTCAATTTCACCGACGTATTCGGTCGGGCCACAAATGGACTGGAAGTACTCAGAGATGACACCACCAACAGCCCACATATCCCAAATGGCGTAGAATCC
CGCGGCCTTGTCAGCGACCTTAAACGCGTACTCCTCAGCTTTGAGAAACGTGCCGTTGCTGCTCGTTCCTGAGGTGATCAGATCCTCGACGATACTCCCG
AAGGTTTTCCGCAGCGTATCTCTCGTAGCGTAGGCTTTTTTCTCGTTGGACTGTGCGATGAGCTCGTCCATGCAGTTGTTTGTCGCAATCGGGATGTCAT
TCAGCACGAGAGTCGACTTGCTCATAGCAACGCGAATGTCGTTCTCAGACATAGTCGGGTTGTGCTTACGGAACTCTGCGATTGTCATCCACGTGCGATC
CAGCAGTCGCTTCATGTCGTAGCCGCAAGTTGAATTGGATTCCAGCGAAGTCTTCAAGTTGGTGATGTCGTTTTTGCCGAGCGACTCGGCCGACTCGCCC
ATCGAGACATTCTTCAGGAAGCCGGTGAAGCTTTCCCAAGAGGATACGATTTCGTCGGGGTGTTTCATGACCTCCCTCAAGGTCGTCTCAATAGTGGTGA
CAATCCTATCGGCGAGCTTCACATTGTCCGGCACCTTCTTTCCAAGGCAGTAAGTGACTGCCACCGGAATGTCGATAACGATATTGTCCGTCTGATAGAG
AATCGCCATCACTTTTTCTTGTGGAGTCTCGGGGTCGGATGTCTTGACATAACGAACGTACTTGATCAGCGACTTGGTTAACCCCAGCCAGGCCTTGACG
CACTTGAAGGCCCTTTGGAATCCCTTCGCCAACTTCCAGAATTTGAAGAACACACCCATGGTAGTATAGGAGTATAGGACATCATGGCCTGGGTGACCGC
AAACGTTTTGGTTGCGATTTCCAGCCGGCAATCGTCGTTCTGTCGGATGCACTCCATTCCACACTCGACAGGGTACGCGTATGGGCATTGAGCCCAGCAC
ATTCCGAGCTTGTAGCCGTAACCTAGCGGGCAGTTCTTCGTGATGTGGGTCTTTCGGTAGCACGCCGAAGAAATCGCAGTGTCGAGCTCGGTCCCCACCC
AATTTGTGTAAACCGACTCGATCGTGCTGGTCGCATTGACCACGCTGCCAATCGCGAACTGTAGGGCCGTGGAGCCCGAGCCAACGGCCAAATCCGAGTC
GTCAATGCTGTCGGACGATTCATTGCTGACTGCGGAATCGGAGTCGTCCTCGCTGTCTTCAGACTCATCGTCACCACTTGAAGACTTGAGAGTGGGTGCT
GTTGTTTTCAGTCCATGTACTCCGGCGGTCGTGAAGTTGTCGTCCGAATCCGTGTCAGCGGGCGCCACCGTAGCAAGTGGATTGGAGGTTCTGGGCCATC
CGCCAAATGTCAGGATCTTGGCCGAGGAGAGCCCGGCGAAGATGGCTACGAAGACGGCAAACAGTACATGTACAGCCAGCCTGGACATCCTGCTGAGTCT
CGCTCGCGGGTGCGAGGAAGTTTGATGAGCCTCGAGTTGGTGAAACGAAGAGTGAGAGCGAGCGGAACCCTGCTCTCGATACTTTCTTTGTTGCGAGGGA
CCTCCTTGCTCAACGACAATCTCGTGCTTGTCGGCGCTGTAAGCAGCGACGGGGTCATGGTGGGCCCGATTTCACCAGAAGCATGCTTACCGTGTTGTAA
ATCGGTTCCGGTGGACATGTCCACGGGCACAAGCGAGACAACATTGCACGGCTTCAACAACACACGACAAAGACCTCCAATCATCTTGGTGCGATTTCGG
CGACACCTGGCCGTGTGTGCTCGTCGCAGCGACGGTCGCTGGCAAGCACAGCTCTGTTCCCGAGCTTCTGCGCCGCCATCTGGTAGAGCAACTAAAAATA
TGCAGACCCACACGCCACGCTCGTCACAAAGGCTGCTGGCTCCTCCTCCAACCACCGTGAAATACATATCTCGCAGGTGTAGGCTCAGCGAGAGACACCG
CATCTTGTGACGTTGAGGCGCGTAGGATGCAGAAGGGGATCGGCGCTGGCCGTTCTCAACGAACGAAGAG