Description :
From Genome Similarity Track
Location :
Scaffold_157:9128- 11715
Sequence
2587 bases(100 bases per row)
ATAAAGGCACTCGACATGAAATCGAGCTCAAACCGGGCTCGAAGTACTGTGTCATGAAGCAGTGGCCACTGACTCGTGAGCAAGTACTTGCGATCGACAA
GTTCTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGGAGTCAACTTCCGCTCACAGCTCTCCGACCTTCTGTGTGCGCAAGGCCACCGGAGGATGGCGG
ATAGTGCACGCATTCAACAAGTTGGATGCTGCAATGGTACTGACTCAGACGCCGATACCGAAGAAAGACGTAATCATTGATGGTATGTCAAAGAGTACCA
TCTTTTCGTCCATGAATCTGATGGATGGCTTCTATCAGATCCTAATGCGTGAACGGGACATCCTGTACACGACAGTAAGCACCCCGAGCAGTATGCTCTG
GGAGTGGCTATTAATGCCACAAGGGCTTAGTAACGCCTCTGCCACCGTCGATAGATGCGTCACAAATCTGTTGAGACCGGTGCGAGACTTAGCACCGAGT
TACTTCGACGATGTATTCGTCCATAGACGGGCTATGGGCGGAAATGCAGACGTAGAGGTTCATAGAACTCACGTTCGTCAGGTTCTTACACTTATGAGCA
GAAATATCCAACCTCAAGAAGTGTATATTCGCTGCTAGCGAAATACCATTTCTTGGGTGCATCGTGGGTAAACTCGGCGTACGCCCTGATCCTAAAAAAA
TTAGGACGATTATCGACCGGCCTGTGCTAGTCGACGTTAAGAGACTAAGAAAATTCTTTGGTCTAGCGACGTACTTACACAAGTAATCGCGCAACTACGC
CAAGATGACCGTTCATCTCTCTCGTCTCTTGAAAAAAGAACGAGAAGTGGTCATGGAATTCTGATTGTCAGCGTTCATTTAAGGTATCAAGCAGAGCTTG
ATGCAATCGCCAAGACGGCGATTGCAGACCAAGACAGACCATTCCATGTGGTCTGTCACGCCAGCGATTTTGCAATCGGCTGCGCGTTAATGCAGTACGA
TGCAGACGGCGCACAGCGTGTCGTCTGTTATCAATCGCGTCAGCTGCAAGCAGCTGAGCGTAATTATCGAGTGCATGGAAAGAAACGCTTTGCCATGAAG
TATACACTGGCGAAGTTTCGCGTCTATCTCCTTGGAGATAGGCCCGTTTGTAGTCTATACGGACCATGCGTCATTACGCACGGCCGTAGACAGCCCCCAC
CTCTCGCAAAGGATGGCGAGGTGGCTGTCCTTCTTTGCGGAGTACAACTTTTCCGTGGAGTACAAACCCGGACGACTTAATGTTGTCGCGCCACCCGATT
TCGAGTCGGCTGCGCAGTCCAACAGTGGGGTTGATAAAACTGTTGCAACGCTAGTCACTAGTGTTCCGTCGACAACATTGCTTGACGACATGAAAAAGTT
CTATGCAGTAGATAAGGCTCTTCTGCGACTAATGGATCATCTGGTGACTCCATCTCGTAAATTTCTCAAAAAATTATCGGCCTTGTATCGGTCTTCCGCG
GGTCGATACACAACACGCAACGAGTTGCTGTATTATACGTCCGTTAACGGCAACACACCTCGTTTCGTCGTCCCCACCCATAATGATTTGCTATTACGCA
TCATGTATGAGTGCCACAATGCACCAACTAGTGGGCATCGTGGGCGTGAGAAGACTTATCTCGCGGTAAGTCACGACTTTTACTGGCCCCGCAGTATCAG
TTTGTGCGCGATCCCTCGGAACACGTCTGACTATGTCTACTTCTGACCATCCCGAGACTTATATTCAGACAGAACGCGTCAACCCCGTTCTCGAAGAGAT
CCTTCAAGGATACGTCCAATCTTTCACAGATTGGAGCGAATTTTTGCCGATGGTGCAGTTTGCAATCAACAACTCCATGCATGCATCGACAACGCATACA
CCATTTTTCGTGAATGGCTTACGCCATCCACGCCTACCCACCCATTCAGAGTATGACACCAATTCAAGGGGAGGAGGGATTTGCTCGAGCAAAAACCGTT
CTGGCTCTTGCTCATCACGTGTCAAGGTAATCGACGACGCGAACGTTGCCGATGTCGATCAAGTCGAAATCGAAGAAGATAACCTTATCAATAGTGATGA
CACTATTTCTGACCCGGATGAGGATGATGATGCTGGTATATTCAGTATCGCCAATGAATACACCAGCGAGGATGAGAACACCCTCGCTAAAAAAAGAGGA
TGACCTCCTAGCGGGCACGCACAAGGCGCACTGCAACAAACCAAAGTGATTCAGCAAAAGATTTCCTGCTGGCACGAGAAGCAGTGGTCCATTTCGTGCA
AGACTCCATCGCTAACGCGGTAGACCAGCATTAACAGAACGCTGACAAACATGGAAGAGCAAACGTTCTTCTATTTAATGTAGGAGACTTAGTCCTACTG
TCTACCGTAAATATACCTAAACACGTAGTAACTAATGTGGGTAGTAGTATACTACTACCCAAGTACATCGGCCCGTTCCGTATACTACATCGCAAAGGCA
ATGCGTACACGATCGAGTTACCTCGCAGGATGCGTATGCATCCCACGTTTTATGTCGGTCGTCTCCGCCCGTACCATCATCACGAGG