Description :
From Genome Similarity Track
Location :
Scaffold_478:9128- 11276
Transcript NameFunction/comments
Hyaar_Emoy2814192hypothetical protein

Sequence
2148 bases(100 bases per row)
CGCTCAGCTAAATGAATTTTTACTTCATCCGGTAGACAAATCGATCCATCAGCCAGACCCAAACTTACCCCCGCATGTACCATACATCCATACCTAGGAG
CGCTTCCTGGACCACGTTATTGCCTAACCAGGCGTCAAAATAATATACCAGCAATTTGTTCGACGTAATGTTAATATTGGTACGTCCCTCCGTCGTGTAT
CCATTCTCACCAATCCCCACACATTCTTGCATCTAACTCTCTTCGATAGTACAGCATACCTTACGAGCAAAGGTGGTGTCGCAAATTACGTCTTCAGCTC
CTAAAAAAGTGGCCTTTTCGTTGTGGATCCTGCCCATTGCCTTGGCCTGTTTGAATTTTTTTGCAGGTGAGTGGAACTTTCAATATTTAAGTGATTCATC
CGGGTCCAAGCCGAGATTCATATCGGTGGGCGATCTTCCATACTCATTCACCTGTTTAACGCTTGATATAAAACGTAAACAATTAGGATCCGAATATCGT
GTAATAGAAATCGAGCTATTCTGAATGTCCACGTCTCGATTCTTCGACCTTCTTCCAACAAAAGCATAAATGCAGAGCCTATATTGCTAAGCTCGTATTA
GATTCCAATCTGGCGAGCGACTTAATTTAACATATCCTCCACCTTTAGCGGAAACATCCCAGCATGATTAACGGGTACATACCACTTGCGAATTAGACTG
CAAAAGCCATCTGTAGGGACTTTCCACTTTCATTTATCCCATTCGCAAAAGCTGAAATCACTTATAAGCATTTATCGAACGGATATCCCTCCGAACATAC
TTCTATCAGGCCATCGAATTCAGCACATTCGTCCATCATGTATAGTCAATCTGCAATAGGTGCAAGATCTCGATCGTTAACCGCGATCACATCCGTCCCC
TCATTTGACTTTGGATAGCCAAGTACGAAGATCTTTGTATGACACGGTTGATCAAGTGTAGTCTTCCTAGAAAATAGATGGTTATATGCATCCTCATCCA
AACCACTTGTCTCTGACTCCGATCCGCTCATTTCCCCACAAATCACACGGACCGCCCGGGTTACTTTTAAAGGCACCGGATTTGTAGGGAAGACCGCCCG
ATGGCGCATCTTGCCTGATCCCACCGACGTTTTCATTTGGAGGGTTTTCACCCGCTGATACGCATGTAGGATTTCCTCCATCTCTTCGGCGTTCCCTTGA
TCACAGTAGAGTCCGTTACTTGGCCGTATATCGATCGTTTAGTGTTTAATAAAATGTTCTATATGTTCGCGTCGCGTAGCTATCTCTCGGATATTGATCT
TGGCTCGGATCATTGCAACGATAATTGGGTTTATCCGATCACTTCCGTGCGTGATAATTATGTCTGGCTACTAAAAACGTATGTCCTCCTTACTGTACCA
GATAACATGCCAGCAGCGATGTCCACTTGTGACGAAAAGATCGACTCAGTTGACTGTACCAATATCATGGCGTCCGGTTAGTAATTGAAGAACGCCAAAC
ACTTTTCTTCATCTGGCGCTTAATCACGCAGAAACGCGACTTAATCTTGCTGATCCAGCTTCTGGCGCTTAATCACGCAGAAACGCGACTTAATCTTGCT
GATCCAGCTTCTGGATCGATATTCTTCTCTGTCTATGTCATTCAATTCCTTCAGTTACGGAATCGTTGAAACGCTAGATGCGCCCAAGAAGTAACATATC
ACTCGGTAAAGCTTCCGTTGCGAATACCCACGGACGCCTTACATCTTGCTGCCTCATATATTACGGAACGCCATCCTCAGTCTTGCAGATATCAGCTCGA
CCGTAATGCGAGTCGATCGATCCTATCTCAATGTCGGAGGTGAACGTATCTTGAAATCTTGCAACCTCGATCGTTTGACTTGGTTAGATTCCTTGATGGG
CCTTATTCTGTTGCTCTTGTTAAAATCGCTCCATGGCCGCGTCAAAATATGACTGCAAGTGACGTTGAGTAGTCGAACTCATATCTTCATTGACGCTATT
GTTGTCGATCGTGGTAGGGCTTGATCGTCTCTACGCAATCAAGTAGATTTTCCAACCCACTTAAACTTAAAATCATCCGCTGAATACCGATACTGTCTTC
TGACTCTTTTCTGATACAGCTGAGGCGTACTGCAACGATACGGTGTGG