Description :
From Genome Similarity Track
Location :
Scaffold_19:91275- 92667
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05384Hypothetical protein

Sequence
1392 bases(100 bases per row)
CAAGTTGGAGCTTTCGTCCGTTGGGGTTGTACTGTAGACTTCGCGTGATGTTGGTCAGAGAAATCACACCCGTGGTTTGACCTGGGGCAAGGTTCACCGA
CGTTGGTGGTGCGCCGACGTCGACCCCAACCGTCGCAGTGCCATTGACGGGAGCTACCGTAGCATTGAGGAAGCCACTCACGCCGCCGACACGAGTCAAA
ACGATCGACGCAGTCGACACGTTTTCGTACAGAACGACGGTGGCCGGCGCTTGGATCGATCCTGGGGACCCGTAGAGGTACACGGTCGCTGTCGTCGATG
CATTCGCAGCGGGCGGCAGCGTAATGTTGATCAAGTGCGGTACGTCGGTGACCACGAGACTGTTCCACGTCTCCAGCGTCAAAGTATGCGTCACGTTCCC
AGCGCCAAACGTGATCGACGGTGTCGTCGCGGCCGTGGCCGAAAACGTGCACATCGTGGCCGAGCCTGTCGAATTGCACACGAGGTACCGTCCAGCAGGT
GCGGTTGCCACCGTGAGCGGCACAACGAGTTGCCCGCGGGCCCCGTACAGTCGCTCGAGCGTCAGGGTCGTGCTGTTGCTGCCGTCCGTCAAGAAGACCG
CCGGCATCGTAAACGAGGCCACGCCTATTTTGATCTCAATTTTCAATGCCGCTTGTGACGTGGGGTACGAACCTGGCAGGTCGAGTAGCGTTGCATACTG
AGCTGTCGCCACGGGGCTGACGCCTTGGGGCGTGACCACCTGCAGCGCCACGTCGTACGTCGTCGCAGCGTCGAGGTTGCTGAGCGACCACACGGTCGTG
CTGGCCGCTGATCCTTGCACCGTCGTATTGCGGACGACACGACCCGCGAGCGACAAGGTCGCTTGAAACTGCCACACGTCTTCGGTAAAGTTGGTCGGGG
GCCATAGAGAGAGGCTCAGCGTGTACGAGGACGCAGTGAGGAGGGCAACACTCGGAAGCCCCGGCAGTCCCGTCGTCGTGGTTGCCGTTACCATCGTGAG
ATTGCTTTTCCCGGCGTAGTTGCTCGTCCAGACGACGACAGTGTACGTCACTGATGGTGTGAGACCTGCGATGGCAAAGCTTGACGCCGTCGATGGGATC
GCGAGCATCGGCGACAACGGCATCGGCGCGCCGAGAGGATACCAGATAGCATGGTTCCACAAGACGTTGGTGCCGCCAGTGTCGCAAGACAGCGCAAACG
CGAAAGTTAGCCCCGTTGCCTGGGCGCGGGTCCAGGATACCGATGGCGTCATCGGTGGCTGCATCACCGACGCCACTGTCGTCGTCGATGCGGAGGGTCC
CGCGCCCACAGAGTTGAGAGCCATTACCGCGTACTCGTACGTGGCCCCGGCGCGAATGCCGCCGCAGTCGGTATAGGTCGTCGCGCCCGACA