Description :
From Genome Similarity Track
Location :
Scaffold_247:9127- 10678
Sequence
1551 bases(100 bases per row)
TCGACTTCATACTGGTTTGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGA
TTAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTC
CAATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGTGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATA
AACAACCAGACTTGATTTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATC
TTTTCTCCGTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTG
TCTGTTCGCTTCTCGGCGCCACTCTACTGCGTCCGCCGAGTTGCCTGGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTG
CCGTCCCAACCATGCACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATATCTTGAGTTGTCGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGT
CGGCTTGAAGTGGGTCTTCTACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTAGCTTGTGGTCGGTAACTCAGCGT
AGCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAATACTTCACTCATAAACCTTAATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAACT
GCCTGAAGACGCATTCCTCAAATACCTTTGGCCACTTCGAGTGCTCCGGTCTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGATCCTGGAACA
GCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGA
TAACCTCTCAACTGTGGCTTGCTCTTACTAGTATTGCAGTCCTCGCAGGCCTAACAGTTTCACCACTGGGTGTAAGGAACAATCCCATAATTATTGCGTT
TGGATCTGCGGGGTTAACTTTGCGAGCGTGTCTTGGATGCCCCTCCCCCCATGGGGGGGCCCCCTCCTCCGATGCGAGTTTGTGGCAGTTATGAAGTATT
TCGTCGACCATGGTTGACGGAATCACCAATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCTAGTCGGCGGGCTTCATCTCGGCGGTATAACAGGCTGT
CTTCGCTGAGTACAAAGACCTCTGCGACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTACAATTCACCTCTCAGGTACGCCTTCAGATCGGC
CCACCTGAGTTCTTCATCTTGTGCCTTCGCGATTCGTCGTCTCACAGCTCA