Description :
From Genome Similarity Track
Location :
Scaffold_17:9127- 10129
Transcript NameFunction/comments
g4599.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
GTGTACATGCGCGCACGTCTTGCACTTTTTCGAGAAAGCCTTGGCAACGAACTGTTCGCATCGGCAAGAGCTGCATGGTCCTTGGGCAGCAGCAGCAGCA
GTCGATGGACGGCGTTGAGATCCACCAGTCGATTCAAACTGGGCGATGCCATCCATGGCTTTGTCGAGGGCATCGTACAAGGGCTTTGCGGCACGGGGAT
GCGGGACTGTTCCACTCAAAATCTCCTCCGGTGTGAGTTTCTGGCCGTAGAAGTTGCTGTTCATTTCTGTCCGCGCCGTGATGACAGCACCATGCAGCGA
AATGCCCGCAAAAAGGCCACGACTGTGCGAGTAGCTGTAGTTGGCGTTGAACCCACCTCGGCTAGCAGCTGCTTGTGCCAGCGCGTCGCGTCCGTAAGGG
CCCACCGCCACGCTCAATCCTCCTCCCACGTTAACTTGAGTTCGGTGGAACACCTTGACGGCGTTCTTGGAGCCCATAATAATCATAAACTCGATGAGCT
CGCCACCACCCTCGAGGCCACCGCCAATACCCGCAGTACCGATGGCAGCAGGCGCAGACCAGGAGCCATCATCCAGCTTGGCAATCACAATACCCGTACC
TATCTTGGCTGTAATAAGCAGTCCCGCTTTGATAACTGTGAGGAAGGCGATACCTTGCGCTCGCTTGAGGAAATTGACAGGGATATAGCGGTCGCTATCA
GCGCCAAAGTCTGGACGGAAAAAGTTACCGAGAATGTCGGCTGCGGAGCGGCACGCGCTCTCCAAGGACCGACTGTACGGTAGATGCAGTCGCGTCTTGG
CTTCGTGTGGGTTCTCCTTGTGACAATTCGCATACTGCGAATTCAGCCCGTCTTGGAAGCACTGCAGGATGGGCGCGCAGATGGTGCAGACACGTTGCGG
GTGTGCGGGGTCGTACTTCTTCCTCATGCTCTCACTCGCCACTTGGTCGGGCGAGATGAGCATCCTCGCAGGAGAGCACGAGTGGCACACGCTCGCTCCG
CA