Description :
From Genome Similarity Track
Location :
scaffold_53:9126- 10356
Transcript NameFunction/comments
Pl_111010hypothetical protein PHYSODRAFT_525062

Sequence
1230 bases(100 bases per row)
CATCTGACTCAACGCTCAAGTTAAAGCCCAGTCACTGCACCTTGGTGCAGTCGTGACATTCGGAGTCTGTGGACAAATCCTGACCCGCTCCCGCAAAAGC
TCGAGGCATTTGATACCATCATCTCTCAAAGTGCAGCGAAGACATTCAGCGATTAAGCTGGAAATTGCGAGGATTCGGTTCAACCTAGCAGGTCGAAATG
CCGGTGGCCCGGAATTACGGGACCCCGAGAAGGCAACAATCACGCGAGGACTTGCCCGTGTCGATGCAGGTGAACGGCTCCAACTCGAATTCGGTTGTCA
TGATGAACCCTAGTTACAGCTACGAAAGTGGAGAAAGTAGCACCGTGTACGAAGCAAGTCAACGTAGCGAAGAACCGTCTTGGGACGGGTACGGAGACCA
TCCGAGTTCACTGCGACGACGACCACCAGCAGTCGAACCCATGAGGGAGTCGGCTCGATTGAGTGATAAACGACTGCATGAATTGGGTGCGGCGGCTGCT
TCGAGCGTAAATTGGAGCGAACTTGACCTCGAATTGGCGGCGGCGAGTCTTAGTGCAAAACACGAAAGCGTTTGGAAGCGAAAGAAGCTTCCACGAGGAT
ACTCTCATAGCGACGCGATGAAGCTTTTCACTCGTTTAACTGTCCGTGACCATCGACACCAGACGCGATGGGGACCAAAGGGGTTTGCAGTCTTGGCAGA
AGGTACTTTGCCCTGCACGGTGCAGGAATTGCGACTTGTTTTTCGCATTGCCTCCACCGACACCTTTCGTGATATGATGCGTTGTATTTACCGCCGTGAG
TTTGTGGAAGGTGAACTTTTGCGTACCATCAAAATTCAACGTGGAGCTGGAAACCCTGCGAGGGCATTCGAGAACAGAGAACTATCTGTCAAGACTGCGA
CTTTCGAAAGCGGCAGTGTTTTCTCCAAGAACGAGTCGTGGTGCTTTTTGGAGTTTTTGCATCCTCGAGACCGAGCAAAAGAAGAACAATCGGCGAGGAG
AACAGCTTCCACCACTGCAAGTGCTATTGGTGTCAGCTCTCCACCAGCTTTCACTAGAACACTCGTGTCTGTCGCGCGTTCCAGCGTCGTCCTGGATAAT
GCGCTCACGCCACCGCCACGATCACAACAGTACGTCCCGAACGTTGTCATCAATTACTCGTTCGAAGAGGACCCCAGTGGCCGCGCCACTCGTGTAGTTT
TCCATGGCGAGTACTTACCACCTGATGCCC