Description :
From Genome Similarity Track
Location :
contig_14:91245- 92249
Transcript NameFunction/comments
g2913.t1ATP-dependent RNA helicase eIF4A, putative

Sequence
1004 bases(100 bases per row)
GCTGCGCGAGGACCTGCTGCGCGGCATCTACGCCTACGGTTTTGAGAAGCCGTCGGCCATCCAGCAGCGCGCCGTCAAGCCCATCCTGCTGGGCCACGAT
TGCATCGCCCAGGCCCAGTCCGGTACCGGTAAAACCGCCACGTTTGCCGTGTCCATTCTGCAGAAGATCGACATCAACCTGAAGGAGACGCAGGCCCTGA
TCCTCGCCCCCACGCGCGAACTCGCCCAGCAGATCGTCAAGGTCGTCGTGGCCATTGGCGACTACATGAGCGTGCAGGTGCACGCCTGCGTCGGCGGTAC
CGCCGTGCGCGACGACATCCGCACCCTGCAGCAGGGTGTGCACATCGTGGTGGGCACCCCCGGCCGCGTGGGCGACATGATCAACCGTCGCGCCCTGCGC
ACCGACGAGGTCAAGATGTTCGTGCTGGATGAGGCTGATGAGATGCTGTCCCGCGGTTTCAAGGACCAGATCTACGAGGTCTTCCGCTTCCTGCCCGAGA
AGGTGCAGGTGGCTCTGTTCTCGGCTACCATGCCGCTGGACGTGCTGGAAGTGACCCACCGCTTCATGCGCGAGCCCATCCGCATCCTTGTGAAGCGCGA
CGAGCTGACCCTTGAAGGTATCAAGCAGTTTTTCATCGCCATCGACCGCGAGGAGTGGAAGTTCGACACGCTCTGCGATCTGTACGAGACGCTGACCATC
ACACAGGCCATCATCTACTGCAACACGCGCCGAAAAGTGGACTGGCTCACGGAGAAGATGCAGTCGAAGGACTTCACGGTCTCGGCCATGCACGGCGACA
TGGAGCAGCGTGAGCGCGACATCATTATGCGTGAGTTCCGTTCGGGCTCGTCGCGTGTGCTGATCACCACGGACCTGCTGGCTCGTGGTATCGACGTGCA
GCAGGTGTCGCTGGTCATCAACTACGACCTGCCCACGAACCGCGAGAACTACATCCACCGTATCGGTCGTTCGGGCCGTTTCGGCCGTAAGGGTGTGGCC
ATCA