Description :
From Genome Similarity Track
Location :
Scaffold_7:91229- 93356
Sequence
2127 bases(100 bases per row)
CGTATGTAACCCGGATACAGTTGGTTGGCTGGCAGTTGTTAGTTTTGACCAATAAGAAGACCGATCTCTTATTGTTAGGGGCAATGATAAATTCCGTCCT
TAGGGCCGTTCCCCACGGGATCGCGACCAGCCATAGATCGCAACAAAAGCAACATGCTATAAATAAAATGCAGGATTTACTATAAATCTCTTTTGATAGC
TTTGGGCACCCGATGAGAAACGTAAAAAACATACCGACAAGAGCTGCACGTAGCACGTGAGCTCTAGTTTACTAGGATACCATCCTTTCACGCAGCAACG
AATATTTGGTGCGGTAGCACTGCGCCGAAGCCGCTGCGCGATCCGGCGATCCCGCTCGGCTCGCGATCCGAGACTCGGGTCGCAGGGGGTACACAGTCGG
AAATAGGCGGGACTAAACTGACCAATCACAGACCAAGTTTGGGATCGCGATCCCGGTTAGGAACGGCCCTTATTGTTAGGAGTAATGAAAAAAAAACCGC
GAGACTAGGGCTACGCGAAGGCTGGGATAGATACATGATAATATTGGTTGGAATAGGGGAAGTTACTTCATCGGGTGCGCTTACTCGTCGATTGTGCGGT
ACACGGAGCCCCTAATTGAAAAGCAAGCCTGAGGCTCAGGCCCTGAACACGATTGGGCTCGTTACATATTGCATAAGAAGGTACAGGTCAAATAATCAAA
AGGTAGCTCGATAATGTACGGGCCACGGACATCTCCTGCGCCTGCTTCGCAGCCGCAGCATCTGCCCGGGAAGCGCGAGCGATTCTCAAATGAAAACGGA
CTTTCTCGTCAGCCATCATTCTCGTCGGTCAACATTAACCTTAAAACTACCGGTTCATCACCAGTTTGTACCTACGGGACAAGCGAGATCATGACTGGTT
ACCCGGGCCCCGGGTCAAGCCCGTGGGTCCCGGGGGGGGGGGGAGAGGGTCGCAGTTCGTAAGAAAGGTTAATTGTGGTGTATTATTAGTTGCGTCTACC
CTAGTTGTAGCGTTTTTTAGTGCTTGCCGCAGTAAGCGACTATATGTACCTATCCTTACTACCTAAGTACCTAAGTATCTAAGGTATGGTTAATTGTATT
AATACTTTTTCAAAACTAAAAATTGTCGTTAGTACGCTCTCCTCACAAAGCTACGTAGAAGACTGTGAAGATGTAAGCATATTCTAAAATCCTGTTCGAG
TGAAATTCGATCAACTTGATCATCAAGACGCGAATCTAAAAAAATGACCCCCGTTGCAAGTTCGCCACGGATGAACTTTTAAGTTCTACTTGTTGCTAGG
CACGCCCAAATACATATTCCATCTGGATGTTTCGTCGGTCCTTCTCTTGGTGAAAATGCTAGTGATAACAATGCATGACGGAAACTTTAACCCTTTAGTT
GCCCATACAAATTCTATTTAACAGTTCGCATACTTAAATCAAGATGTTTCCACAAAACGATGCATCCTGCATCGTTTTGGCACCCATTTGATGATTGCGC
TGTTACGTGCCCTCTGCGCTTTAACATAGTGTAGTGGCGCCATGGCTACATCTCGTGCCAGCAGGCATATCGCACGCAACGGATGCGACAGCAGCTACAA
AACGGACTCTAGCGAGAATCTGGGAACTGGCAGATTGTATTTGACTACACTATACTGCATACTCTAGGAAGCTTATTGCTCAGCGAAATTAACAGAAACC
AGTGCGGCCTTTGCCGCAGCGGCAGCATTCAATACAGAATCCAATTTATCTGCAAGCACAAGGGTCGCAAGACACTACAAAGTTATCTTTAGCTGTGGAC
GACGATCCAAGCATCGGGCGCCATGAGTCGGCCCCAACGGAAGCGCAGTCGTGCCAATACTGCCGGAGACGATGGCGACACGACGACACAAGCAACGACG
AAGCTCTGGACGGCGATGGAGCCACCATAGATAAACGCGGCATTATGCAGCGTTTTGCAGCGTTTAGCGGCTGCAACTTGATTGGCGGAAATTAGCATAA
TGCTAAAGTCATCGACCTTGACCGTGTAATTTATTCCTGCACTCTATCCGTGTCGTGTCGCAGACATCAAGAGAAAATACTTAGGATGGAAGCCGAGAGA
GCGAAGGGGTGACCGCTACAAACCAGT