Description :
From Genome Similarity Track
Location :
Scaffold_57:91224- 95761
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014005Similar to sll1024: UPF0187 protein sll1024 (Synechocystis sp. (strain PCC 6803))
Pytul_DAOMBR144PYU1_G014004Similar to Rad51l1: DNA repair protein RAD51 homolog 2 (Mus musculus)
Pytul_DAOMBR144PYU1_G014003Similar to RPL35: 60S ribosomal protein L35 (Gallus gallus)

Sequence
4537 bases(100 bases per row)
TGATGAGCGCCGTGTACTCGTCGATCTCGGGCAGCGAATCCTGGGTCACGAAGCCCGCGGCTTCTTCGGACACGCGGCCCTGGTGGAACGAGAATGATTC
CTTCACGGTCTCAGGCGCCTTGGTCGAAGTTGTAGGCTTGGAGTTGAACGTTGTCTTCCAAGAATCAGTCGATTGCCCTTGAAGGCGAGTGAGCGAGGCG
CCGCCCGAGATGAAGTAGTATTGGCTGCGGATGAGCACCGTGAGCTCTTCTTCAATGTGCAGCAGTCGAGCTTCCAGGTCGATATCATTCGCATCGAGAC
CAAAAGGGCACTCGATCTCCATCGCGACCTGATCAGCCGTGAACAGGAACATGCCCCACCCAAAGACCCAGAGCGGCGTGTAGTACCCTGAGCGAGGCAC
GATCACAAACGTGTACAGCATCATGTACGCAATGATGAGATAGTGGAGGTACTGGAAGTAATTGAACGGAATCGGGACGTTTGCGATATTGAACACTGTG
GTGTACAAGCTGGGGAGCTGCGCGATCTTGAGCTGCAGGTTGTTGGCATTCACTGGGCTCAGGTGGCCGCGTTGCGCGGCGACTTCGACCAATCGCTTGA
GCCACAGCTCGACGATCGTCGCGCGGAGCTTGTGTGGAGTTTTCTGAACAACAGCTTGGTACGATTCTTTGTTCACGATGTGTTTCGACTGCTCAGTACC
ACACGCGTACATCTCGTCGAACTCGCTTTCCGTCAGGATCGCAGACTCTCTCATCTTGTCGATGCCGTCGCGTCCTCGGCAGTCGTGGAACACGATTGCG
ATGTAAAGGAACACGAGACGACGAAGCTCTGAGAAGAAAGTGCACTTCTCCATGATGTCGCGTGGGATCTGTGGTGAGCGAACGTTGTCGCCTTCGTCGG
TCTTGGCTGGTGCACTTTGGTTGATTGGGAGAGTCGCGCTCACGTACGCACACCCGGAGGCAACAATGCCACGCGCGGCTTCCGTGAGCGACCCGACCGT
GACGACGCCGCTTCGCCATTGTTGGAACGCCGAGTTCAAACGGAACGAGATGGTGAGACCCAGGAACGTGTTGAACACCGTGAGTGTGTCGACAAACGCC
GTGCTTTCGCGCGTCGGCACGACAAACGGGTGGAAATCGTTCACAGCCGCGACGCAGAGCGCAAAGAGCGCCATGAATACGGCGCGCACCGGAGCTGGGC
CATTCAGCGCCGAGCCGTGCCACCGGAAGATCACGTCGCGGATCTGATCCGTCTCGTAGTAGATCATCGTCGTTCGTTTGTGCTTAAGGTCGGTCAATCG
GCAAATAAGAGCGAGAAACCACCACAGACTCGAGTGAATCGAGGGGACAGGAGAGCGAGCGTGGAAGAGCGCAACGCGCAGCTGAAACGGCCGCAACAAC
CAAAGCCTCCAATACCGAAAGAATCATGCACGAGCACAATATGCTGCTTTACGAGCGCAGCTGCATCGCCAGGTGACTCGCCTGCTGTTTCTACTATCAA
CTCTAAAAACCGTCTCCTTTTTTCCATTGTGTTATTATACATCGAGTAACCGTCAACGTTTATCCACAAAGTATCGGGATTGATGATTGGGCAAACCCCG
ATTCCCTGCCGATGACTGGGAAGACAAATGCGTTGAGCGAACGTTGCGCAGGCAGTATCCGGCATGTAGATCGACATGGAAATCCGAGAGCACTTGTCTT
TCTAGTTGTGCAAAATTCCGCACATACACGCCCATATCCATTGGTGCGCGATTGCCCACCACCGCTCCATCTTGTGCCCTTTCAGGAGAGAAAACTTCAT
CAAACCTGCGTAAAATCATACTCATTAACATATTCTATTCAGTGGGTGTATGTATCGTACTTGAACGAGTCGATTGGATACCACAAACTGCAACTTTCAC
CTTGCTAGCATCAAGATCAAGACGAAGGCGGAGGGAGATGCTGCAGCGCGCACTGGTGAAGGAGAGCGTGGCCGAGCGCCAGCAGCAGTTGTTCCATGCG
GCGGGCATCCGGCACTACAAGCAGCTTGCCATGCGCTCCAGTTGGGACCTTGCGCACGCAGTGGACGTCTCTGTGCAGGAGATGGAGGTGCGTATGCACA
TTTGTGCAATGCTGGTTTTGTTGTGCTCAGCTGATGCGCCATGGGTTTGTCTGTTGCTTACGCCACTAGGACTTGTTTGCGCGGATCTCGACGCGGCTAG
CTCCACCCAATCGAACAGTACGATTGAGTGTCAATGTCTTCATGTCAAATGGGCTGTAGCTAAGTGTATGTGTAATTTGCTGGTAGGAAGGCGTTTGAGA
TGTTCATTGAGAGCGCGAACCACCCGATGTTTCTTCGCACGGGCTTGCCAGCGATGGACCAAGCGCTCAATGGCGGTATCAACTATGGCGGAATCACAGA
GGTATACTTTAGCGTCTCCCCTTATCTTGAAAGATATTGCGAGCGTGTGTGAGTAGTGACGTTCTCGATATGTAGTTTACTGGAATAGCAGGAATTGGTA
AAAGTCAGCTTGCGATGACGCTTAGTGTGCTGTGTGCGATCGAGTACCCCGCCGCGACGGTCTTGTACTTTGATACAGAGCACAACTTTAGCGCGAAGCG
GTACGTATCATCAATACTTAAAAGTGCAACGTGAGCACTTCGGGTGGATTGCTGCTGTGACAACAAATTCGACCTTGTGTGGAATCCACTCAATACAGAA
TATTTGAGATTGCCACGGCTCGAGTGCGCCTTCGAAACGTGCATCCGGATGCCAACGTGGAACTGGTGGCACAGGAAATCATAAAACGGATCTGCTTGGT
GAAAATTGACTCTCTGGGCAAGTTCATTCACAAGTACGTCAAAAGGACCAAGGAGATCGCTGCAGCACATTGAGCTTGTTGTATTGACTCATTCGTTATT
CTCTTTGCGTTAATTCCAGGCTAAAAGAGCTTGAAGAGAGCATGCACGCGATGAACGTAAAGCTGCTTGTGATCGACTCTGTAGCTAGCTTGTTCATGAA
GGTAAATTTCTCTTCATTCAAGTACAATGGATTTGTATACTATTGTCCCTACATCATACTCACTTGTGTGCACTCGCTATTAACTAGTCAAACGATCAGA
CACCAGCACAGCGCCAGCATCAGATGCTGAAGTTGACACGAGATCTCAAGCGAGTTGCGCCGAACTTTTACTTGAGATATGTATGACACCTCAAGTCTAA
CTGACGCGGCACGACTGGAATTTAGGCTGCTTGCCGATACTCATCACGCATTTGTCGTGGTCACGAATCGCGCTTCGACAGCTGGGGGTGCTGCAGGATT
GTACACTCGAGCTCATCTTGGCGAGACGTGGGCCCATTGCGCCACCACCAGGGTCAGATTGCTTGCCGTTAAAGGTATAGAAAGCATAAACGTTGACAAT
TTGTTATGCTGTAGGTTGTATTGGAACGATATCCTCAGCATCGCATCATGGCAATCGTCAAGTCTCCTGTTGCTGGCTATGTTGTCCAACCTTACGCAAT
CGATGTACGTCCGGTTGTATTAATTTGAAAACTTTTCATTCGTCGAAACAGTTTACCCCAATTCCATAGTTTGACTTCAGGATTCTAACTCGTTTTTGCT
TTTATTCTCGATCCAATGCTTAGGAATCCGGTGTGCAGGCTTCGGTGGATGAGGCAACACTCTCAACCGTTGAGACGGACAACTTTGATGTTCATGATGA
TCTCCTCTACGACCTCGCGAGTTTGCCGATGGTGGAACCATCGTGCACGTTTCGGTCCACCCAGAAATCTTCCGCGAGGGAGGAAAACGATGGCGAAAAT
TCAGACGAGAGCAGCTTCGATCTGTTTGATCTCGTCTCGGACTCCAATGATGAAGATGATGAGTACGACAAGTCCATTGGGGATCTCACAGAAGATCGAT
AGCAGAAGACTATATTTGTTGAAGGTGACGTAACTCTATCATGCTTTGGATAAGGGGTAATTCATGATGCATGAAGACTAATGCGCAATGATCCAGACAA
AGCCAACACTCGATGTGATGAAATAGTGGGAAGCTGGAGTGTATCATTTATTCATGCGAATTGAATTCACAAAATCCACTAACTTACGCCTTGAGGGCGA
AACGACGCTTTGGGAAGTAGGCTTCCTTCTTCTGCTGCTTCAAGGTCTTGAGGCTCTTCTCGTGGGTCGAAAGCTGGCGACGGATGGCGCGGGTCTTCTT
GCGACGAAGGTCAAGTGGCACGTGCTTCTTCGAGCCAAGGGCGGTACGAAGCTTGGCCTTTTGGGTCTGGTTGTACACAGTCAAGGTACGAGCGATCGCC
TTGCGGACGACGTTAATCTTGGCGAGCTTCGAGGCGGCACCACCAATGACCTTGGCAACACGAAGCTGTTGATACAAGCAGCATAGACAGCAATGTTAGA
AGGTCCTATTCCATCGTGACAAAGGTAACTGCTTGGTATCGTACTTGAGCCAATTCCTGTTGGTAGTCATCCAACTGGCGGAGGAGTTCCGACTTCTTCA
AAGTACGAAGTTCGTGAGCCTTAAGTTGTTGGACTGC