Description :
From Genome Similarity Track
Location :
Scaffold_37:91219- 99948
Transcript NameFunction/comments
Hyaar_Emoy2805273hypothetical protein
Hyaar_Emoy2805274ATP-binding Cassette (ABC) Superfamily

Sequence
8729 bases(100 bases per row)
GTTGTCATCCAGTCTTCGATGCTGCTGTGTACGAGAGGAAATGTTGCGGTAGCCGAAGCCGGCCAAGACTCTCGGGCTTACACTAGAGCTAGGTCCAGGA
ATATCGCGTGCCAGAGCTGCCGGTGTGCAAGGCTGGAAAAGCATCAGCCCTCATCATTACCTCCCCTTCGTTTTGATATTGATTCAACTGCGTACGCAGG
ATCCGCCAAATTCGTTCTTCCTCAGCAGGAGTGGTCGAGTGCGCGCGTTTCTGAGCTGACGGTTGTTCCAGTTCTGTTCGAATGGTTGAAAGAAGAGCGA
TCTCGGAGTTTTGTGCGTTGCGCGCACCGATAGCTTCCTGATCAATCTCGGTAAGCTGGGGCACAATGGAAAGCTGAGACCGCTGCTGGGAATTCTCTCG
GCACCAATTGCGGCTGCATTCGTCCGCCGAGCTCGGTCGGCTCGATTGAACGGCTGAAACCAGTTGTTTTCTACTCGGTCTCATCGGGAGTGTGTCCAGA
AGGTGGTAGGGTGTGCACGTAAGCGGAGCAATGTCCCCCCAGTACCTGAGAATTAGTGGCCGCTCCTTGTCGTGCATTTTAGCCAGGTGTATTGCCTTAA
TACATTCGCCGAACTCCATTGGCACTTTTGACCAGTCTCATTGATCTTGTTATCTCGCGTGGTGGTATTTGAGCGATACAGAGAGCATTTCCATTCTTGT
TGGCTACCCTCTGGATGTGCAAGGAAAAAAAATTTGCGCTGAAGAAAATTGGCTGCGGTCGATAAGACTTCGCTACATCCCCAGTTGTAGCACTCGACGA
CCGCCTGTCGGGGGGGAGGTTGTGACAGCATATTCTGCAAGATACCAGTTGAATTGATTTTTTTAGATTCTGTCGGATCCATGCCGTCCCACCCGCGCAT
CGCGTTGATCAATGAAGTAGTTCAAACGTAGTGGTCAAACTGCTCCCCAAACTTAAGCCGAACCGTTCAATGGATGCCTCGCTTGATACATGCTGTGATA
GTTTCTAGGTCGACGTCCAAGGCTGCCATGTCGTGGTCAGCTACCTTCTGTGCCAAAGCAATGACCATACGATTACTGGATGAAGCTGTGGTTACTGGTC
GAACGTCCAACGCCTTTTTCATTGCAGATTAAGTCCTCGCTTGACCGACAACACTGCTGATTAGAAAAAGATGTAGCACTAAAAGTAGGAGTTTATCATT
GACCGCTGCAGCCAACGCCTCACTTTCACGTTGCCGTAGGGTGACCAGTTGCGGTGTCGCTGGCAAATTAGGCGGTTTCGCTGCAAAGAGGTGTAACCGC
GCCTTTTTATCGGCAGTTATCTTGAACGAATCATGTCCATCGTGGTCTGGTCAAGAAACTATCTCTGGAATTATACGAGTGGGTGTTGAGTATTCTGTAG
AGCATTCGCCTTCATTCTCGTCATCATAAGAACCATTCGCGAGATCTGCAAAGCGAGATTATGTGTTGGAATCGTTTGTGGATGATGCCTGAGGCCGAGA
ATGGAACCGCTGTCGTTGACGAAGAAGGACCGTAACCCACGGTTTTTGGGGGTCGGCTAAACTGGTTCACCTGTAGATAGTGGCTGGTGAATGTCGGTCG
GTGTTCGCTGACCCTGGGACAAATCCACCGGCTCCGTAGCCGTCCGCGGGGGTTTCACAGCTTCCTGCGTCTTCTTATCTTTTCTCCGCCTGATACGTAG
ACGTAATGCCGCCATTTATTGGACCTCTTTCATACTGGCAAATGGAGTAGCCAAATCTTCAAGCCCGGCTACCTCTTGCTCTGTGGCTACCCTGCTTCCA
TACTGTGCAACTGAGGTGTAGAATATTGACACCTAGCCATAGTGTGCCCTAAATTTTCACATTGTAAACATTGAAGGTGCCTCCCCAAATCCGGATGCTT
GAGAACGATCGTTTGGCCATACCAGACGATGCGGGCTATGCCTTGAAGAAATTTAGGGCAACCCGCCATTTTCACTGTGAGTTGCCAGCGTTAGACGTCC
GCGAGGTGGGCGTACATATGTCCATATCATCCAACTCGAAGTCTGCCGCGATATGTACTTGCAAGTACGCCTTTAGACAACCGATATCCGTGAATCAGGT
TACGTTGTGCAGTCCCACAGAATATTCTCGTTGAATGGTCATCCGACGTCCATCGTTCCCCAGCTGGCGTGCCCAGACTGTCCCCTAGTGCAGCTGATGC
ATATTGTTGACACGTTACACCATGCCCTTGAATGGTATAGTAGCCAATTCGTGCTTGCACGCAGTATCCCCGTCGAAAAAATAGAAGTGAATCCGGCGGT
GAACAGGTTCGAATCTGATGGTCTTGGCCACATTGAGTAGGCTTCGGAGCTCTTTTTGGTTCACGCAAATATTTGTCCCACTACGAAGCTGTAGCATCAC
TTCTCCTTCCACTTGCGCTTGTATAATCCAGTACAGTCGTAGCCGCTCCTTGAAATCCAAGACACTCTTCAGGAAATTCGGCATGCGCCGGCCGAATATA
CTACCCTCCACGAGACCGCGGATTATTTTCCATTCCTCTTGAGTGCCAGTCAGGTGCCTACGCCCAATCAGTGCAGCCACCGGTTTCAGACATTTCTCCC
GGAACGTCGCGATGTTCGCCTTACTGTACACTGCGGGGTTAAAAATAAAATCCAGGTATTGTCCCCGAGACATTTGCGTGCTTCTGGCTCCACCGCGTGA
GTCACCGGAAGGCGTACTGGTGTCTAGCCATTGATTAAGAGGTTTAAGTCCGGACCATTTAATCTTGCTGAGCATATTTTACATAATATTCTTAGATTAA
CAGCTGGTATTGTACAATACCTGAGTCGCCTTGTGCACGTGCTGTTCCCAGTCCGCGAAGGAGCTTTCACCGACTATACAGGCCTCGTCAACAATTTCAA
CAATAGGTCTTTCTCGTCCCCACGGAGTTTCGAATAGCGTTTCTTGCCGATGGAACGCACTCAGCATCTATTTTCACAAAATTGTGAGCAGTTGCGTACA
GTGTAGCTATCGTCGTAGTCCACGCTTCCCTAAGAGCTTCATGTGGCGCTGCCTTCCGTGCCGCAACAACGGCGTCAAACATCTCTTACGGATGAACCTT
GTCAATATGCTGTCCCTTGGGCTCTTCGTGCTCCTTGTTGCCGCTGTTAACACTATAAGGAGGCGACTCGCTTACAGAGGGAAAGCCCGCCTCGCCCGTC
AATGATACCGTCGCCTCAGTAGTAGAGTCCGCTTGCCCAGCCTCAGCTCCGGCTGGAGCTGTGGGTGGGTCGGGCCCTGTCTCGTCTGGGTAGGGCTGTA
AAGTCTCACTCGTGCACTTCTCTCCCTCTCCCTCTCCCATAGTCGTAGCTGGATTGGTCCCCCCGGATCCGGTTGTCTGCATCTCAACTCGGATGGCGCT
CCCCCTAAATCTGCCGAGCCGTGCATGTTGTCGGCCTGTCTTCGATAGGTCTACGGTACCCAGTCGCGAAGGACTTTGCGTGATGATAGTACGAGATCCT
CCCTAACCTTGCAGATTGTACGAAGCTGGCAGGGCAGTGCTGAATGCGATGCTAATTTGGAAGGAAAAAAAGAAAAGGGCAACACGACGATTTTTCTCGA
GAATCTACTTGTTTTAGGGTCCGTTCAATCAGCGAAGACGTCCCTTCGCAAATTAAGTTCTCAGATGCAGCTGTAAGTTAAGAATGAGTCAGCATTCACA
GATGTGCAGAAAGCAGTCTGAAACCGGCAATCGCGATGAGGCATGCCATCGAGTCATAAGAAGTCAGAGGTCTGGCTTTAGTTCCTTATGCTGGCTGGCA
CAATACATACACACACCTTCGTGTCAGCTATCGGTACATCACGACCAGCTCGATCGTCAAGCACGTAACTACTTCCCACGCGCAAGTAGCGAGATTCGTT
TCGATCATATTTCGGATTGATCACTACCAACTAGCAAGAGCTTGAAGCTGTTTGCCTCTTTTTTAGAAAATGTGACGTTGCGTTAGAGCGTCTACAGCAG
TCAGTATAACTTAACTTTCCGTCCAATCAAAAAACGTTATTTAGTTATTGCGAGCCCGAAGGGTGAAGGTATTAGTGAGTGTGCGCAAGGTTGAATGCCA
AACTTTTAAATCGTACTTATCTGTGTGTGTCTGTGTGTATGTCTGTAAATAAAGCGGTTAGATGTACCATACACGTATTAAGTGCGATCTAGCCTGTCCC
CACCACATAGGTATATAGGCACATACGAAGTCACTCAATGGTAAGGTCACTGTAGTGGTGCACGCTTGTGATTGGCTTAAAACTGATCAAAGGTGAATAT
GATCACATAAACAAAGGCTGGATGCTCATAAGCAAAGGCTGATCGCGTTGCCCAAGTATACTGTACTGGGTTACCATAGACATTAACAGCATCATACTCC
TTCTTCAGTGACTGCTGCTGTTGTTTAGTGCTTTGCAACTTGATTCAATTTTATGAACTGAATTACTTATATCAAGGGGCGAGTTCCAGAGCTTGCTCCC
CTATCTTATAGTTATACTGACTGCTGTGAAGTTTTTTGCGTATAAGTTTGAGAGGAAGTTATACTGGTCTCTGATTGGTGCACAAGAAGTTGAGTTATAC
TCTCTGCTAAAGTCGCTCTTAGAATTTGTTCCAAGTTCCTGGGCACCTGGTCAGATGACAGTAGACGGTTCCGTAAAACCAGCTCGCCTCGTCTGCTTTT
AAACAGTCCGCAGAGATTTCAGTAAGGTTTTTACACGACCGATCGTTGAAGGCGCAGAATGATGCGACATGTGAATAAAATGACGGTGATTGGCAGCACG
GCATCTTTGGACGAATGCGTTAGCCACTGGTTAAAATCATACCTCCCACAATCGATCGCTTCCATCAATCTCCCTGACTTCGAATCCAGTAAACCGCCGT
TTCACCAAACCCAAAAGTAATTTCACCTCGATCATTTTCCGATTCTCCATGAGTAACACAGGCAAACATGGATGCGATTGATCATAAGGGCTTCGGCAGT
GCTTGTATCGAGTACGACGATGTTAAGACACTGCTCGCTCAAGGATCAGTGGCGCTCCATGAGCACGTAGCTTCTCGATTAACGGCGTCCTTTGGCAAAG
CGCTTCCAAAGGTCGAGGTGCGTTTCAAGAACGTGTCCATCTCTGCCGATATCGCGGTCAAGGACGCGACTGACCTAGAGATGCAGCTACCAACGCTTTC
AAACGCAGTGGTGAAGACCCTATACAAGTTGGTGACCAAGAAACCCGCAGTGACAAAGCATATTTTGAAAGGTGTTACCGGAGTCTTCAAACCGGGTACC
ATCACCCTCGTGCTCGGCCAGCCGGAGTCAGGCAAGTCGTCCCTCATGAAGTTGCTGAGCGGTCGATTTCCAAGTGATAAGAACGTCACAATAGACGGGG
AAATCACGTACAACGGGACACGTGCAGAAGAGCTGCAGCGGCTGTTGCCCCAGCTCGTGTCGTATGTCCCGCAACGTGACAAGCACCACGCTGAATTGAC
AGTGAAGGAGACACTCGAGTTTGCACATGCTGTATGTGGTGGAGAGTTATCTAAACGTGACGCGAGTCAGTTGGTACATGGTACTCCTGCTGAGAATACA
GAGGCTTTAAACGCTGCACGGGCACTGGCCAAACACTACCCGGACGTCATCATTCATCAACTTGGTCTGGAAGGTTGCCAGCATACGATCGTCGGTGACG
CGATGATTCGAGGTGTGTCTGGAGGAGAACGCAAGCGCGTGACGACGGGCGAGATGGCGTTTGGAAACAAGTACGTGATGATGATGGACGAGATCAGCAC
GGGGCTAGACAGTGCCGCGACGTTCGACATCATTACGACGCATCGCAGTCTCGCGAAGACGTTCTGCAAGACGGTGGTGATCTCGCTTCTGCAGCCACCG
CCCGAGGTGTTTGCACTTTTCGACAATGTCATGATTCTGAATGCTGGTCACCTCGTGTATCATGGTCCGTGTACGAAGGTTCAAGACTATTTCAAGAGCC
TCGGGTTCGAGTGTCCTCCGACTCGTGATATCGCCGATTTCTTGCTGGACCTTGGTACGAGTGAACAGTACCAGTACGAAGTTAAGCCCGAAAAGGAACG
CACATTGATCCGTATTTCAAGCGAGTTCGCTCAAGCGTTTGAGCAGTCTTCGATTTATGCACAGACTCTCCAGGAAATGGAAGAGCCCGTGCATCCGAGT
CTTGTCGAAGACATGAAGACCACTATCGTTGTCAAACCAGAGTTTTCTCAGATGTTTTGGGAGGGCACAGTGCTGCTTATTTATCGACAGTTCATTGCCA
CGAAACGCGATACTTTGGCCCTCTTTGGACGCTTGATCATGACGGTCGCAATTGCCATGCTGTGCTCAATCGTGTACTACCAGTTCGACCTAGCCGATGC
GCAAGTGGCAATGGGTATCATGTTTGAGTCAGTACTTAATTTGTCGGTTGGCCAGGCTGCACAAGTGCCAGCATTTATGGCTGCGAGGGAGGTGTTTTAC
AAGCAGAGAGGGGCCAACTTCTACCGGACGGCATCGTACGTCGTCTCCAGTGCTGTGAATCAGGGACCTCTTGTTGTCCTCGAGACGGTTCTCTTCGGAA
CAATCATCTACTGGATGTGTGGCTTCGTGAGCAGTTTCTACAATTACTTGGTGTTCCTTGTGGTGCTGTCCTTGACGAACCTAGCATTCAATGCCTTCTT
CTTCTTCTTGGCGTCTGCTTCACCGAACCTTAATGTGGCAAGCCCTTTATCCAGTGTGGCGATTGTTTACGTCTGTGTGTTTGCGGGTTACACGATCACG
AAAGACCAGATTCCGGACTACCTCATCTGGCTTTACTGGGCAAACCCCATTGCGTGGGGAATTCGTGCGCTGGCGGTCAGTCAATACAAGAATGTTCGCT
TTGACATGTGCGTGTACGATGGCATCGACTACTGTACGAACTACGGGTTGACGATGGGGAAATTCTCATTAAGAACTTATGAAGTTCCGTCGGATGCGTT
GTGGTTGTGGGGTGGAATGGGCTTCATGACCGCTACCTATGCCTCCTTCTTGATCCTGTCGTGTTTCGCACTTGAGTACCATCGCTTTGAACGGTCTGAG
GTTACGGTGCTGGACACGAAGACCGAACCAAAGGTTGCGGATGACTACGTTGCTACAGAGACCCCACGCGGGTCAAGGAAACGGGACGAAACGATGGTTC
CGGTCAATCAAGCAAGCGACAAGTACTTCGTCCCGGTTACCGTGGCTTTTAAAGACCTCTGGTATACCGTTCCGGATCCGACGGATTCCAAGAAAACGAT
TGACTTGCTCAAAGGCATCAGCGGATATGCTTTGCCTGGTACCATCACAGCACTCATGGGGTCTTCTGGTGCTGGCAAGACGACTCTGATGGACGTGATT
GCTGGACGTAAGACTAGGGGCAAGGTCCGTGGACAGATACTTTTGAATGGACATCCCGCCACGAACTTGACCATTCGTCGCTCGACAGGATTCTGTGAGC
AGATGGACATCCACTCGGAGTCCTCAACGTTCCGCGAGGCGTTGACCTTTAGCGCATTTCTGCGCCAAAGTGTCGACGTTCCTGACGATCGCAAGTACGA
CTCGGTGACTGAGTGTCTCGATCTCTTGGATCTTGACCCCATTGCAGACAAAATTGTCCGCGGCAGTTCTTTGGAACAGATGAAGCGACTAACGATCGGT
GTGGAGTTGGCAGCGCAGCCAAGTGTGTTGTTCCTAGACGAACCTACGAGTGGACTGGATGCTCGCTCGGCAAAGCTGATCATGGACGGTGTGCGTAAAG
TAGCCGATACTGGAAGGACCATTGTGTGTACGATTCACCAGCCCTCGGCAGAGATATTCAGTCTCTTCGACAGTCTGCTACTACTCAAGCATGGTGGCGA
GACTGTCTTTGCGGGTGAGTTGGGCGAGAATGCTCATGAAATGATGGCATACTTTGAGTCAATTGATGGAGTAGCAAAATGCAAGGAAGAGTCCAATCCG
GCTTCATGGATGCTTGGAGTGATTGGTGCTGGTGTTGGCAACAACAACGGAATCAAAACTGACTTCGTGGGGATCTTCAAAGGGAGTCCATACTACGAGC
GTCTGCAGTCCATGCTGGATTCCGAAGGTGTGTCCCGTCCATCCGCGTCTCTACCTGCACTCCAGTTCGATACCAAGCGTGCTGCATCGAATCTGACGCA
GATGAAGTTCTTGCTCCAACGCTTCAGCAACCTCTATTGGCGGACGCCTTCGTTCAATTTGACACGCTTTGCCATATCATTGGGACTGGGTCTGGGCTTT
GGCATCACATACGCTGGGAGTGAGTACACGTCGTACTCTGGTGTAAACTCTGGACTCGGCATGATTTACATGATTGTCACGTTCATTGGATACATCGCAT
TCAACGGCTTGATCCCAATTGCAGCAGAAGAGCGTGCTGCCTATTACCGCGAAAGAGCGTCGCAAACGTACAATGCGTTTTGGTACTTTCTTGGCCTCGC
AGTCGTTGAGATCCCGTATACAGTTGTCGCAGTGCTCCTGTTCTTGATCCCGCTTTTTCCCATGGTAGGCTTCTCTGGACTCGGCGCTTTTTGTATCTCT
TGGCTCGTCTTGGTGCTGCAAGTGCTGCATCAAGCTTACATGGCCATCTTGCTCGCTTTCCTGCTGCCGAACTTGGAAATGGCAGAGATCGTTGGCGTGA
TCTGGAACATGGTAGGCTACTTGTTGTCC