Description :
From Genome Similarity Track
Location :
Scaffold_84:91209- 92504
Transcript NameFunction/comments
Phyke_g3698hypothetical protein PHYSODRAFT_495307

Sequence
1295 bases(100 bases per row)
TTCTCGATATTATATTTGAGATCCTCGTCACTCAATTCGACGTAATCACCAAGCGCACCTTCTTCGCCTTGGGTGCCACCGCCGTAGAGATACCAGGCTG
GACTCACACCAGTGTTGTAGTAGTGCGGGGACCACACGAGCTTGCTCTCGATGTTGAGATCAATCGGGTAGGCACCGGCATTCTGCATGCCTGCTCCCCA
CCAGTCGTAATAAGTGTTTTCCTCCCCATTCAAGGTGATAGTGCCCGATCCGGCAATACCTTCAACGAAAGCCATCCAGTTGGGACATCCATCTAGCATA
TGATTACCAATTTTCGTCGCCCCAACTTGCCAGTCCGGTGTTGCTCCGCCCCAAGAACAATCTGCCGGCTCATTCTTGAGGTCTAAGCCCAAGATATTCC
AGTACTCGGAGTCGCAGAGGTTCTTTGTCAATATGTCCACAGCCTCAAGGAAATCATCCTCCGTCACACCGAGTGCTTCGCTGTACCATGCACCGCCCGA
TTTCTTAGGGTCAAGCGTATGGAGACTGATCATGACAGTGATGTGGCGATACCCAAGAGCCTTCACAATTGACTGGATGGTCGTTACGTACGAAGTGATA
TTGACGGCTCGATTCGTGTTCATGTTGATGAGAGACTTGTCGGGAGCCACGTCGTTGAGGATGTTCTTGATGCAAACAGGAAGACGGACGCTGTTGAACT
TGTTGCGAGCCAAAAACGCTGCAATCTCGTAGACAGACGTGCCATTGTCGTNAACTTGTCCGTCGTCAGAGATGATGACttggtcgtcgtcaagtCCGTC
TTTGATCTTGCGTTTATTGGCCAACCTATTCTCATAGTCTTCCGAGCTTACTTTCATCTGCTCATTCGTGTCTATAGCGTGCAATGTGATTGCCACcgct
gcaccaacaacgagcagcaggagaaggagcaatCCTGGCCAAGTCTACAAGTGAAAACATTAATAAGGTCAGTGGGTGTATTTGCATCTCGAAGACACTG
CAAAAGCGATCCAGTATTTGTACTCACCCGAATCCGTCCTTTGTAGTCCTTCATCCGCTCTGGTGGCTTACTGCCATCGATATCGGCAGCCGTGAGTTTC
ATCTCAGTCGTGCGTTGATacgaggacgaggaactTAGGCGTCCTCCCGACTCGGTCTGGCGTTGTCCCGCCGTACTATCGAGATGTAAGCTATAGTGGC
CACTGGCGAAGTCGTTGCCCGGGGAGTTGATGATACTTCCTTGTTGGTCGACGATCGATCCTCGTGGCATTATCGGGCGCGTGACTTCAGTCATG