Description :
From Genome Similarity Track
Location :
Scaffold_36:9118- 11190
Sequence
2072 bases(100 bases per row)
CATGAGTGCCCTTCCATCTAGTGCCTTCAAGGTCGACGTTCGGTTAGAGCGCAAAATGCGCTATGAATTTGCTAAGCTGAAGGCCAAAGGCCAGCTACGT
TCTCTGTATCACAACCAGTATGCAAAACCAGTTGCTGGTCAAACCACCACTGTTTCGATAGACAGTCGCGGTTCACTCGGTATTGACGAGCGAGCCGTAC
ATCTCCACACTTATTGGTGGGAAGCGCATTGGGGTGCAAGCTGACTCTCATCGTGACGCTCAAAAACGTCAACGGCGTACGGGCAATCTTGTCGATAGGT
TACCTCAAACCCATGAGTTCTCAGACTCAGGGTATCCACGCCACTTCATCAGATACTGGTATTGACCTTTATGGCGACGCCGCTTTAGGAGATTCTCCAC
ATGGAACTGCAAGTTCCCTTGCTTGTCGAGCAACGCAGGAGGGGGTCGGTGTGTAGGTCCAGAAGCATGAAGACTTGGTGTCAGAGGTGGCGCGAATTCG
CGAGTCTTTCGCTCACGTACAGACTGCACTGGATCAGTCTGTGACTGAGAGGAAGTAACTTTGGGAGATCCTCGACCAAGTGCAAGGCGCTCGTGAACAG
TCATCGACTGAGTCGGATTAGTTGCGTGAGCAGATGAACCGTCTCGGCTCGATTGACTCGGTAGAGAAACGACTGCAGAAGGTGGAGTATAACCTGCCTC
GACTGGATGGACAGGTTAAGCCCTTGACGAAGATGCATTTAACGGGGACGACGTCCCTCCTTCAGGCGCCAGCGCATTCCGATCCACGAGAGAAGGATCA
TGATATGGCTTAAGCAAGCCAACGTAAAAAACTGGGTGTGTGCGCAACTTTCGCGGAAGATTGAGTGTTTAGGCAATGCTTTCTTCGCTATGACCGTGAG
CGGCCCCATGAAGCGTGGGCGCTACTTTGTCTTGAAGACGGAAGACACTACATTGTTAGGTAGGGTTTTCAGCATTTAGTAAGACTTGGTCTCTAACTTC
ATTAGAATCAACACATCCTCTACCTTTGGCATCAGATTGTTCCTTTTGTTTATCTTGGCTATCCGCCATTACATCACGTACATGTCGTAAGACACTAAAG
CGCGTCACGAGAGACTCGAATATTTGTTTCTGCATCGTGGTAGGGCTGATATCAGTAAGCTTGTCAGCAGACTCTATCCCACCAAGCCCAGAACCACGTA
GTGGTAACGTTAGCGGAACGAGCGCTTCCGTGAGGCTATCCACATAGAAGCGAGTAAATCCGGTCAGGGCATGAACAGCATTGTTCAACGCAAACTCAAT
GACAGAGAGCATCGAGCTCCAAGTCGTAGGCGACTCAGCAAAAAAACTGCAAAGAACATCGCCGATTACGGGATTAACTCGCTCAGTGTGGCTGCCCGTC
TGCGGATGATCCGTCGTGAGCATGTCCATACCAAGCACCTTGAAGATGGAAGTCCAAAACTTTCTTGTAAAGCGAGGATCGCGATCAGAGATGATTTCCA
GCGGCAACCCGTGTTGACGAAACACACGATCGATAAACAGCATAGCTGTACCTTTGCCATCGATGGAATCCAGCACTGCTGCTAATTGATCCATTTACTC
AAACGGTAAACAAAGATCACAATTCCCGTATTGCCGTCACAGTCTTTGGGAAGACCAAACACAAAATCCATACTGATCGACTCCCAACACCCCGTGGGAA
GAGTTAGACTGGCGAGTGGCGCTGCCGAATGTGCTGATGGTTTGAACCGCTGGCACGTTTCGCATATACGCACGTATGTGCCCACCCATTTGTAGAGTTT
GGACCATAGATAATGTTGACTCACAGATCCATAAGTCTATTCCCGGTCCAAATGCCCACTGAGGGCAGTATCGTAGGCCTTGAAGTGGATTCGGTACTTT
AAATCCTCATTTTGAGGCACGACAACGCGAGGGGTATCCGTTGCATCCGTCGATAGCAAAAGAGACCAATATCGATGAAATATCAACGTATGCTGGCACG
CAAACGTGTAGACAAAGAGGTGTTCGAGTCTATGTACTCGTCACTGCCAAGAGCATGAAACGATGCCACACA