Description :
From Genome Similarity Track
Location :
Scaffold_221:91141- 111978
Transcript NameFunction/comments
Phyci_326450conserved hypothetical protein
Phyci_251341Hypothetical protein
Phyci_251347conserved hypothetical protein
Phyci_251370conserved hypothetical protein
Phyci_251376Hypothetical protein
Phyci_251359Hypothetical protein
Phyci_169434Hypothetical protein
Phyci_421019Rab2 family GTPase, putative

Sequence
20837 bases(100 bases per row)
TGCGTCGGTAACACCAACTTCCGTCCGTCCACCTCAGCAGATTCCTCGTTGGTCTCAGGAACCTCCTGGTTCTGGCTCCGGTTCGTCTCAATTCGACTTG
ATGAGACTGTACTTCGTGCAGATCCACTGAATTTCGCCCCGAGCTCTTCATGTCGTTGGAGTCTCCGCTCGAGCTCTTTGTTGGCCTTCCGATACGTGTT
CAGCTCAGTCACCAGTGACGCATTTTGGTAGGACAGCGCTGCTGCGAGTTTGTGCTTCTCTCGGTTCCCAGCTTCTACTTGACGACGCAGCGAATGCTTA
TTCTGCAATAAAAAGCGGTTTTGACGATGGAGCTCGGCGTTCACCTCATCTGCAGAGTCACCACGAGCCTGAAGCGCGTCCAATTGGCGAGTCATTCGCT
TATGCAGGCGGCCGATCTCCGTGACGAGACTGCTTTTCTCCTGCACCGCGCTACGTCGGACAAGCTCACCAAGTTCTTCTTGCAGCACCACAATCGAGTG
TCGGACGTGCTCCAGACGCTTGAGTGCTGTTTCCAATTCGCGTTCGTGTTTTCGAGCAAGTGAGGAAGTTTCAACACGCAGTCGATCGCTGATGTTTGCC
TGCACCACAACCTCTTGGTTGGCGTCGTGCAGCTGATTGAGGTGCTCTTGCATGTGCGCCAATTCACGGTCTTTTGGCAAGATGTGCTTCTGTAAAAGCT
CAAGCTGTGAACGGTGCACGCCGTCTAAGCGCTGCAGGTTCTCAAACAGCCGCCGCTGCTCCGCGAGGTGCGCTGCAGTCTCATCTTTCTCGCTCATTAC
CTTCTTGGTAAGCGCTTTCTCGTCCGCCAGCTTTTCACGGAGCATTTCGATTTCGTGTACGCGTTCGTCGTAGTCGCAGCACATTTGCTGCAACTCGCCG
TCCTTATGGTTCAGCGCACTGAGCAGCATTTTAACTTCTTGGTTCAACGCGGCAGCCTTCCCATGCTGCTCAGCAAGCTGCATCGCCCCCTTTTGCTTTT
CGCAATCGATCGAGGCAGCGAGCAGCCCCATTTGCACGAGTTGGTCTTGGTCTTGCTGTCGCAGCACTTCTTGCAGCTTCTTGTGCGTGATCTCAAGCTC
GTCAGTCAACTTCTTCTGCGTTGCGTCGTACTGAGCTTTGGCCTCTCGAAGCTTCTTCCTGCTGTCATACTCGAGCTGGAGCTCACGTTCTTGCGCTCGC
TTCTGCTCATCTTCCAAATCAAGTTTCGCCGCATGAAGTTGTTCGCGGAGCGAGTCGCGTTCTGTTTGAAGCTTTTCTAGCGTTACCAAGTAGTGATCTT
GTGCAGACCGCGCGTCTTCGGACAACGAGCGCAGCTTGGCCTCCCTTTCATGAATGGCCCCGCCGAATCGCACATCAAGTTCTGCTCGAAGCGCCTTTTG
TTCCTCCTCAGCTGTCCTGGCGTGTGCAGCTAACTGGTTCTGCATTGTGTTCTCGAATCTGTTCCGCTGTTCACTCGCCTGCCGAATGAGCATTTCATTC
TCCATCTTGAACTGCTGGAGCTCGCTGTCCAGATCCATCAGCTTCAGGCGAGTCAGCTCTACCTTGTTGCGATCGTACACTGCTAGCTCCTCTGGCTGGC
AAATGCCTGTAAAAGAGTTGATGGACAAGTCGTGGAGGTTTTGGTCGTCTCGAATTGCCGTCGCCAAGGCCGAGGAGCTCTCTCCATCTCCCAAAATCTC
CCGACACAGTTTACTCGCTAGCACAACGCCATTTCGCGCATTGGAGAGCAGCAACCGCGAACGAGACGCGTAGAACAAACCCACTATCGGAGCTGTATGC
AAGTCGACACGCTTAATTGCTTGGCTAAGGAGAATCGTCGGATGACTTTCGTTTTTTCGAGGACCGCGCTTCCAGCTGAAAAGCACAACAGCACCCTGTG
CTGTACCAGCGAATAGCAAATTCGAGTACACCGTGCCATCGCTACCCGTGCTAGCGCCCAAACCTGGTCCTGCCTCGAGAGATGTGACCTCGAATGACAT
ATTCTCGCCGACAGATGAACCACTGGAGTTATGAAGAGCGTCCGATGCTAGCTCTCCATTCACCCACGCGCGAATAACGCAGTGACTGCTGGTTCGCTTG
TGCGGAGCTGCGGTGACCCGCTTTTCAACCACGAAGACTGCGTAGTCGTGGCTTTCACGGTCCACGTAGCTGGTAGCGAACGCCACAATAGCATTGCCCG
GTGCAAGTGTCTGTGCTACTGCGTGCGATACCACAAGGTCTTCCACTTCTCCCCCAGATTGCCACCGCAACTGACAGTGACGCAGCTCTCCAGCTGCATC
GACAGCGAAGAAGCTGCTGTCATGCACAGCCCAGCGGAATACCTCGACCGTGTCGCGAAATTCTCGAAACACCCCGACAAGCTGCGGCTCGCGCTGTACG
CGCGATAAACTTCGATACACAAACACAGCCTTGTTGGTTGCGTGAACTGCTGCGAACAAGGCACCACTCGGACTGTATTGTGCGAGCGAGAGCTGCTTCT
GCGGCATCTCGAAGGCCAAACGCAGCGAATCGTGCAGAACGAAGAAGACCTGAAGCTTAGACGAGAACGTGATCAACAATTCGGAACCCGCGGGGTGCAT
GTCGATACTCAGCGGCGCCTGCTGCTCCAGCGGGTGAGAGATGAAACACTCGTGGCAATCCGTTTGGTTCCACACGTGAACTGCTGCGTCTCCGTCCGGC
GCTCGACAGGCTGCAGCAAAACACGGTCGTCTCGAAGCTGCACACAGTCGCTCCATTTGCTGCGAGAGCGGCGTGGACGACAACAAGCTCAGCGCAATTG
TTTCATCATCGCCGCGAAGGAGGCACATGTTGCTGAGGTCGTACGCGCCGTAGCCGTTTTCAGTGCAGCAAAGCAGCATGGACGCTGCCGGATCCGTTGT
CACGCTTGCAACGCGCTCGCTGCGAGTACCATAAGAACCACAACAGTACATTCAATTCGCGAGTCGCTCATGAAGCAGCACTCCACAATGTGCATCACGT
ACGTGTGTGGAATTCGCATGCGACGCTGGAGATGCAGCTCCTTCTCGTTTGCCTTCAGCATTTTCGATGCCACTCGCACGACCGACACCAGCCCATGGGT
GCCACCAACCACGACGCCTTCGCCGCTGGTTAGCGGACTCATGCACAGCATCCTCCCCAAACCTTTGTGCACTGCACGAAGCGTCTGAACCAGTTCGGCG
TTCACTATCAACTGCACGTCGCCGTCTTCGAGCAAACCTACCAGCACGTCGTCGGGCAGCCACGCGTGGTCTGCGTAGCTCACCACGTTTTTCACTCTCG
TCTCGTCACCAGACTTGAAACTCGCCAGCGGCTTGAGCGTGTACTCGCAGAGCGTCCAGATCCGCAGTAAACTGCCGCCGCTCGTGGACAATTGCGCCAT
ATCGATGACGTTGAAGCGGACTCGGGACACTCGGCAGTGCACGTCCGAGAGAGCAATCTGTCGTCCGCGACCCCAATCCCAGACGCCGAGACTCCAACTC
GCGTTCGCGGCCTGAGCACTCACCAGCTTACCATCAGGAGACAACGCGGTGCCGACGAACTTGTCCGTCCAGGCCACGGTCAGCGTCTTGAGCAGCACAA
TGCGGCGAGTGCCTCCGCTTTTGCCGTTGGTAGTCGATTCAGCCTTCTCGCTTCTTGCGGGGATGCTGTAGATGGAGATGGAGGCTGGCGAGCTGATGTT
GTCCGCCACTCCGTCGTCGGCTTTCACTGCAGCACGACAAACTGAGAGGTGGCGACGCTTTCCACACAACGCCATTGCGGTGATCTCGCCGAGAGAGGCC
GACGATTGCTCCTGTCCCGTGACGAAGCTCAACTCCTGCGTCTGCGTGTTCTGCAGCACGACGTACTTGCCGATGACCAGCACGAGTTCGTGGCGACTCA
GAGGCAGTAAGACGTCTCGGAAGGACATGTCCAGACCATTTCCATTCACCGGCACCAGCGTCGGTGGTGCTGGGGCCTCACCGGAGAGAGAACCGACATC
ACGCATGGTCGATAGCACTCACCCGGCGTGGAGGAGAGCTCTGGTCTCCATGTGCCGGGCATTGAGGGCGTTGTCATCCCCTATAAATACGGGGTAGTGT
CGGTAGCATGGTCCGCTGCTCCATCCCATCGATCACCTTCCTGGTGGTTCTCGCCACAGCTCAACCCGAATGGCGAGCCCCACGAACACGACGGTGTCTT
CACTCCACTCGACGATCCGCTCGCGGCTCGATACGCTCAAACAGCAGTGCCACAAGGTCTGTGGCGACGTCTCCGATGGTCATGCGAGAAAGTCTTCAAC
ATCTACCGGAACGACTGCACCACATCCGCGACACGAGTTCTTCTCGAGCGTGCAGCTTTGGAAGGAGCGGTCACTGCACCGCACACTCGAATCGCTGGAT
AAAGCAGGCTCGCCGTCCGTGGACAGCCACATGGAGGCGATCGAGGACCATGAACGAGCAGCGGAACATCTCTTCGACTTGACGCGAGTGTTTCTCGACC
GAACGTGGCAGGACACGGACGCTCTTCTTGACGCCTTTGCGGACGATCTCGCTGGGTTGGTGGACGATATCGTCGCTGCTAGACTGGAAGAGCAGCGTAT
TATCCACGCAAACGTCGTGAAGGGTATGAAAGAGGAGAACCAGCGTCTTGCTAAAGCGTATCAGGAGTTGAAAGGCGTCAACGGGGACCTCGAAGCTCGT
CTGGAAGTGTTCGAGAACACTCCGAACGCTGGAGGCGATGCCATCATGTGCAACAAACTGCGCAGCAGGCTGCATCAACTTGTGGTCAATCATCATCAGC
TCTCGGTGGACCTTGAAGAGGCTGCGGAGGAGCGTGTGAAGCATCGACGAGAGCTCGACAGAGTGAAGACGCAGCTACTCGACGTTCAGAAGGCCTTAGC
ATTGACGCGCGCGATGCACGACAAGGAGACCAGACAGCTAGCAGCGATGCTACAGCTCAGTCACGCGCAGGTTCATCAGGTCCTGGAGGCGTCACGAAAA
GCTAGTGAGAAGGGGGCAGACCCGAGACGTCAACAACAACTAGAGAGATTCGATCCGTTGTCGGGATGCATGATCGTGCACTTAGCTCCCCTCGCAACTC
CACAGAAGCCACAAGGTTCTTTTCCGTCCAGCACTTCTCCTCGACGATCAAGCTCTCCGGTCCTCGCAACGTCACCAAAAAGACTTGAGCGACCCAAGTC
TGCCACCCCAGCAGGTAGAAGACTGCTTTCAAGCGCTTCAAGTGGTGGGGACAAGACCCCACGTCCATCAAGTAGTAAACTCTTTCGACCCTCTCCACGC
AAGTAGATCGCATTACGGTTAGACCATCGGCAAGAACCCTCCGGGCTTCTCTCCTTCTCTGCTAGTCGGCTCCTCCTGAAGCTGTGGGTAGTCTGCAACT
TTCTTCTTAGTCTCGGCCAAGAAGTCTGCGTGCATGCGCAGCTCCGTGCAGGAGGTGACTTGCCTTAAGTTAGTCGATCCTGAATTCTGCGGCAATGGTA
GCGCGTACTTCCTGTAGAGACTGTAGTTCAGCGTTCCGTCCGAGCCTGACGGCGACTCAAGTGGCAGCGGCGCCGTGGAAATCGGCCGAGCGAGTGTTGT
GGTAGCAAAACGTGCCTGACGATCTCTATCGCGTTTGAGATTTTGCCACTTCTCACTCCGCGACGACGCAAAAGCTCGCACGGTGGACACGAATTCCTCC
TGGAAAACCTCCGCGTCCACTACAGGAGCTCGGAATCCGTGCGCGCGATACTGATTCTCTACTCGTTGCTGTCGACACTTCCGCTCTCGAAGCTTCTGCT
GCTCTTCACAACACACTCGATCTCCGTGCTCGCGAGCCGCAAGCGAAAACATTTTCTTAGGTGTCGCCCTCGCTACCTGCAGTAGTTGCTGCACGTCCTC
GGGCTTTCGTGTTTTCTTCTCGCTTACCGTCGCCATCTCGATAGGTGTGGTGTTCGGCCGGCGACCGCCCTGAGTGCGGTTGTTCCCGTGACTCGAGGCC
ATGGCTTTGGCCGCGAGCTTTTGGTTGCGGTGCTTCCGCTTCATGTCGAAGATGTGCTCGGCCAAGTCCGTCTTGAGCTTCATGAGCTCGTCTTCGGCTG
CCCCCAGCCGCTCGGTCGTCACAAGTAGCTCAGCTAGCGAAGCTAGTTGCGCTCGGTGGAACTGGTCGCGCTCTGCCAACGCGAAGTTGCGCTGCGAGTC
CGACATCGCTGCAGCCACTTCGGCTCGCTGCCAGTTGTGAGCCGCCTGCTCCTGCTGCTTGACACTTGCCTGCATTTGTGCCAGGACATCGTCTCGATGC
GCTTTCAACGCCGCCATGTCTTCGTGGGCTCGTTCCTTCGCTCTCTCAGCGTTGGCAAGCGCCACCCTCAACTCCATCAACTGCTCGGTGAGACTCGCTC
TCTCCTGTTCGAGCTGCTGGTTGGTGTCGACTTGGCTGCGAAGCTGCTGCTGCGCTCGTTGAAACATCTCCATCGTGAGTGCGTGGGCACTCTTCTCCTC
TGCAAGTTGTGTCTGCACCGACTGCAATTCCATCGCCATTGCGTCGAGGCGACGACGTTTGTCGTTGTTCTGCGTCTCGAGGTGCTCGGCGCGAAGCGTG
AGGTCTTCGAGCTCAACTTGCAGAGCTCCGAGCTTGTCCTCCCAAACACTACTGCCTCCTCGCAGTCGAATGACCTCCGCTACTGACGAGTGCCCCCAGT
GCGTTGCGAGGTCTAACGCTGTGCACCCGGCAGCATTTTTTGTCTTGAGACTCGCCCCTGCTGCCAGCAGCAGCTTCGTTAGTTCCATTCGGCCCCAGAA
GCAGGCGAGATGCAGCAGCGTTTGGCCGCCAGCATCGAAGTGGTCGACATCGACACCAGGCACGGCTAACAGCTCGGCTACGCGAGCTCGGTCATTGTCG
AAGATAGCGTCTCGAATGAGCTCGTAGTGCGTCTCGGAGACTGCCGATGCCTCTCGAGACATCTCCGTGATGACCAGAGCAGTGTTGAGGCATGCCAGAC
TAGCTCGGCGCCAATATTTTTAGTGGAGCGATAAGGTTGATCGACATGTTTGACTAGCATGGTACATTTAGCTGCCGGAATCGACGATAAGATCGATGGA
GAGCACTAGCGAGGTGGAAGCCAAAGACGAAGAAACGAACTAGGTCAATGCATCACTTGAGAGAAAAGTTGCCGGATAGTCAGCATGAAAGGCATCCATG
GCAGGAATCCATGTCCAGATGCATCAACTAGAAATTCAAAGCCCATGCGCGTCCATGGCGGAGGTGATACACGGTCTATTTCAGCCAAACCTGCTGAATT
TGGCGCTTGTCATTGTCCGAGACTAGAGCGTTATTCTCCGTTTCGCCCAGAACCAGGCAGAGCGTGTGGCTCCGCACTGAGTAATTCGCCTGACATCCAC
CATGATGGAGGAAAGCGCCATGGGCGACTTCGCCAATAGGTGAGTATTGCTAGTTTATAATGCGTTTGGGTGGATTCGACTGAGTGGACTGCTGGTTCTG
CTGTAGGCTCAAGCAGGAGTTCGAGGACCGAGACTCCAATGCCAGCGACGGAGACGAGTGTCAAGACTGGTTTGTGAATGACTCGCCCAAGCACGAATCG
GTGGCACCGATGGACGAGGAACCATCTCCCAAGCGGGACGGCACGAGGGGAGCAACGGTTCCTCCAGCAGCATCACCAGCTACAAGAACGACTCGATCTG
TCAGTAGTCCCGCACAACCAGCGACTAAAACTTCACCTTCTGACACCAAGACAATTACCGACGAGGCGAGTGCATTGAATTTGGGGTCTTGTGCAGTAGT
TGACCTGGTTTTCGTTATTGGCGATGGCAGGAACACGACGAGTGCGACAATGTCACGGGCCCGATGGCATTCTTGCACCACACACCTCCGTCGTTCTCGA
TCCTCGTAATGGAGCTAACCACTGGAGTTGAGGTAATGCAAATATTGGACAGTAAAATGTTGTCTAGTGCTTAGATATTTGTTTTGGCGGCAGGTTCCTC
GCTATGGGACCAAGTTTTTCCGGATTTACATCCCGCAAGTTCACGACAGCCAGACGGACTTTTGTTTGTTCGCGCGGAAGCGACTCAACAAGTACAAGTT
TCGATTCAGGTGAGGAAGTGCACGCTTAAAAAATAAATCGTGGGATTATGATGTATTTTGCTGCCCACTCACCGGTGCGGTTTGTATCTCGCAGCTTAGA
CGAGAGCTTTACGACTAGCTGGACGGACTCTTGCTACGGAGGGAAAGTTTTGATGACTCCATCCGCGGACACGAAGCGCTTTCGACTGCTGGCCACGAAG
GCAACGGGTCGAGTTCATTTCGACATCAAGCAGGAAGCGAGAAAGCAGGAGCTCAGCGTTCGTTTAAATACTCCGGTACGGTTGTCTTCTTGTATGTGTT
GGTTGTTGAATTTCTAACCTTCAACGATGTAGGCGACTCGATTTCACTTTTTTCGGGCTCGTTCAACGTCCGTGGACAGCAAGAGCGAGGTCTACCGCTC
CAACATTCAGGTGGGGGTTGAACGCTTTTCCCACTTAACGAGGTGAATTCGCTGACAGCACCCGTTTCTGCAGAAATTCATCAACCCCATGGCAGACGTC
CGCTGTTCAAAAACCAACTACACTCTATTCAAGATTGAGAAGGAGGGCGTAAGTGTTTTGCCGCGAATGCTCATGCAAACCTCGATCCTCTTCGCTAACA
TTTTGGTGCATTTTTAACAGGAAACTGGCATGCAGAAGTACGTCATCTCGTACATGCGCCCATTCTCGCTCTTCCTCAGGTGATGAGGCTACTTTGTTGT
TGTCATGCAACGCGGGTTAGAAAACTAACTGTTGATGGGAATGCTATTGTACTTGGTTAGCTGCTGTATCGCGGTCGGGGTTGAAGCACATCTGCTAGAA
TAATAATGCTTACAGTAAGATCGCTGCAAAATACAGCTAAGCTTTCACGAAGTGTCCCGCTCGAAGAGTACAAACTGGCAACTGCTCTTAACGTCTAGCG
TGACAAGACCGCAGGACGTTGCTTTAGCGATTGACTGACCGACAGCATCATCTCGATTCCTCGCAGCTCGCGAACTGTGTCCTTCACCTGCGAGTCGGAC
TGGCACAGCTTCGCAAGTAGAATAGCAACGTTTTTGCGAGCGAGCCCGTCTGATAGCTCTTGCAGAGCTTTCACCAGCACAGCAAGCGTGCTCTTCTTCC
TGAATGTCTTACTATCGTCCAGATCATGATCCGACTGCATCGCAATCAGCACCTTGACGACATTTCCTACGAGTCGCTCGCACGCAGTTGTCTCGCCAGT
CGGTCGATGATAACTCTTCTGCGCGTTTGCAAGTGCAATCACTTGAGTCAGCAGCGGCACGGCATTTTTCTGGCGCAATAAAGCACGAACACTTGTGACG
TGAGCGCACCAGCCCATGTGGCACCAAATCTGAGCACAAAGCTGCCAAAGCTCATCCAGAATCGCAGACGCCTTGCCACTGAAGCTCGCGTTAGCGAGTT
CACACACCGTGTAGAGCTTCGACAGAAAGCTTTGCCCGGTAATACGACAAAGCACGTCTTCTTTTGATGTGTTCTCGCCTCTGCAGGAAGAGTGCAGACG
GCAAAGGAGACTTGCAACTCGTGACAAGACGAGAATCGACTCTGCAAAGCTTGATGATCTTGTCGGGGTAAGAATACTCTCGATGGCATCAACAGCCCCG
AATTCAAGGAGGTCGTGAGTCCGTACTTGCGAGACTTCAGCAAACGATAGGTTTAGTAGTGCTCCGAGAGCTCGTTCAGAGCTTGTATAATTCCTCGAAG
TTGAAGATGCCGATTGCTCTTCGCTGTATGTTTCCTGTGCGATCTGAAGCGAGACCTGCACGAGTTTTCGGCGAGTGTCCTCGCAGTTATTGCCCTCGAT
GGTCTTACGAATTGCGCTATCGGTGGACAAATTGCTCAGAAAGCCCAATACATTTTGCGTCGTAGCACTAAACTTGGTACGACCACTCGCTTCTAGTGCA
TCAGCGACAGCCGCAAGGCATTCGCCACCACGACCACTGAACGCCTGAATGCCAGCATTCTCACTGCTCAACGTAAAACAAATACTCGATGCTGCCAGGG
TAATTGTTGTTTTCGAAGCCCTTTCATCGCCCACTTCGTCGATGCGAAGGCCCAAAGCTGCAAAAAGTGATGCGAGTACTTGTTCCGATGAAATCATCGC
GTTCCGCCAGCTCTTTGAATCAACAGCCTGCTCCAGAAAGCGGATGATACTAGCTTGGACTATCCATGAAGTTGGTCTGGAAGGCATTTCCCCGAATGAG
GCCAATACCAGCTTTCGGAAATCCAAATGACGAAACATAACCACTTGGTTCCGGGGTGTGTCGGCCACAGCTGCCGCTGCGCAGTTCATCATTGCGCTGA
TGGTCACTTCCTCCGTTTGTTGCCGGGAGCTATCGGCCTCAGCTTCAGGATCTCGTGAATCCAGCGCAGCTACAATACGATTGCAGAGTTTTTCCATCTC
GCCAGACGTCCGGAACTTCGCGCGGACGTGCTCATTCCTCTCCACGAAAGGCAGTAGGAGGTCGTAAGCTATCCATGCATCTTGCAAGGGCCCTTCTGCG
GTTGCATTGCCCGCAGGTGCTTGCTCGTCCATCTTCTTGAGTAATTCTATCGCGAATCGCAACTCCTCGACAGAGGATGGCCCAAGCGATAATTTCCCGG
GGTTTGCTTCCCCCGTTTTGCGCTTGGAATTTAAAGCCACTTCCAATTCACTGTTGGCGACCGAATCCTCGTAGTCTCCGACGATGATCGAGTGCTGCTC
CACGATGTCAGCGTTGTCGCCGTCCAGCTCAAACGCTTTTTTCATGTCCTCAGCGGCTTCTTTCAGTTTCTTCTGTCGGTGCCAAGCCGTTGCTCGTCGT
GACAACGCTTTCACGTAGTTCTCATCAACGCACAAGGTGCGCGTGCAGAACTCGATGCAGTCGTCCAGCTGGTCCAGCCGCAAGTAGCACTGCGCGATAT
TGGCGAGAACCGCCACATTGAAAGGAGAGGCTGACAGAGCCTCCATGTAGCTCTTGATGGCGTCCGGGTACTGCTGCTTCTTGTACAAGCGGTTGCCCTT
CTGCTTCAGACCTGCACACACAACAAAATCCACGTCAATCTAGATACGCAAAACACACAAGTCACCGGCCGCTCACGCTCAGCAGTGCGAGCCTTTTCCT
CCTGGGAGCGCTGGCGCTGCTCCATGTCCTTCTTGAACTGGTTGCAGAACTCGGGGTTGTTGGTCTCGAACTCGCGGTTGCGCAGCTTCTCGAGCTCGGC
CTCTCTCTCCGCCTTCTCCTGCAGCGACACGGGGTCTTCGGGTACCCACTGGTCCCACAGCGAGTAGTCGTTGGCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNaggccctggtctaagtaaaagttttgaaactcgttctgaacgaacttgcgttttcattggctaatatcgcatgcggcactcagaacgagt
ttcggttttggacccgttctgtatggcgtTCTCAGAGcgagttttggcgtagccatatgctacttctgcccacatcacttccgatgcatttcgctgcgac
agcaatcccagtgaggcaaactcacgttgtctcttgctgtaggactgcgcacggaggtagacaaggtcagcgttggtccctgtgtgacggagctcacttg
tatgtggcttgcaggacgaccacgagcctctcaccggcttgcaggtgtgaactgctattacacgttcagaactcgttctgaccacgcttgtgtttgggaa
ccaatttcggaacgcgtctacatcgaccagaacgtcgcgttcggataacccaacacctacttggaatctcagtacggttttacttagaccagggccAGGG
TGAAGATGTGATGTCTCACTCGAGGCGTATGTCTCACTCGATCCGATAAATACGGTATCCCCTTATTGACGCAGAATATTGTACCTATTGTTCACGATTA
CGCTAGTTACTCAGCAGATGTTGACAGTTTTtaacaggcgatccagttaagagggggacttttttggggggaaactaaaaaaaaaattaaatgcggaaat
tgtcctatttcaatgaaatttttgtcggaacataactagaatttctaatgacgaatgaatcaagcccggttttcgtagctgcattggttgtgccatggca
aggcatgcaagcagcatgccgatacagtgcgaccccccgttttcgcggagggtggaccataaaagaaacgagagggtaataaacaatgccatggatatta
aaatgatttgctatttgatactgtatttcacttaatccgggccttataactgaagcctgtgcggcaccagcagttgcgaatagttcatcggagacctttt
aaagccctcagagcaacacttcattgcggagaagagatccacagtcatataccatgttggcgctaagacaaagttcgtgtttctgagttagtgttagcgt
agtgtaccaggaggggcgacgcaacatttgtacgacacagaaatgtttaatgtgggcaggggtatgaaaaggtctatgcaccagagtttaagtcaatctc
ggagaacgtgtcatccctcccttgatacagggaaaacctttgaaaacggagatgtgcaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNactcaccatagttaaatcaaatacagtttgaggacatcatttttgag
acaaaaaaaagagtgggataggacatcaattttgagacggagtagtaTCACGGTTGCACTGCATATCCACCGTAATTCAACCAAATTCCTCTCCTTCTGT
TCAAGCGACCATACTTTGCCTCCGTGATACCGTAAACCCCGCAAAAGTTCACGAGGTTCGTATGCTACCCTTCGTGCTACACGTACCTCGCGATACCTCA
AACCTGACTGTACTATTCCGCGCCTGGCTCTGTCAGCGACGCTGGAACTgtagtaagggtctcgcgttcattgcgatacttaagagccatctgtctgagc
ctcctgcatagtgtagcgttcacatacgtcggatctctctcttctgagactgtgtaggcgaggagggacggaataactcgcttccattccttcgggacgt
gtgtaatagcagctcgtcgaagtcggtagttgtcgggaagggttcggaggtcggcatcgaagaccacaggaagcgtggtgcgttggcggtcgcggaactt
gggattttggcttggcgcgaagtaggcttccttgtagcggtaggtgggtaagcctgacgtcgttgtcgagagtcggagaatttggccaagtaacgttcag
cggcgctcgagaagacggcatcAGAGTGGCTCGTTCCTGTGCGGTCGTAGAGGTTGTTGTTAGAGATGGTATCAGGGTATGTCACACCGATAAGTTTTGT
GGAGCTGTCGGCGATGAAAACCTTAGTCCGCGCAGTTCGGTTTGGTTAATGCTCAAGGCTCGCTGGTAGCACGGTGATATTAAAATCTACCAAACTATTA
ATACATCTGTTAAAAAGTAAGAACGGCTCTGAGGGCAAACTGTACTAAGTCGTCACTTCGTTAGCTGAAAACCTTCGGTTTTACGCCTCGAGATTCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNatttcgctccgcagtccatagagccactcaagtcctgctcctgctcaagaagcaagaaacgcca
accatgaatctatacgccttcctcctgttgacaGcgactacgacaactttcctcgtcagcggcgaagctctcgctgctgctcagaccacgatctcaagag
tgcagtcgccaggcccgctccgggtggttgtttctccgtccgacgagaaaaggTCTCTGCGAGCCTCTGGTATTAGCAGAAGCAAAATGCTGGAGGATGA
GGCGTATCGCAACGAGATCTTCCAGAAATGGCTCGGCAAAAACCACTCGTCCATGTATGCCTACGATTTCTTCAAGCTAGACAAGCACaaaaagtacgaa
aagtaccgcgacctctacgataagtacgctaagctccacaaggaatctggcaggtatccgtaactgcgCGGAGTGAAGCGTCCGCATTCGTGCGACCCCA
CCCCATGAGATTGTCTACAGACAGCGCACGTAGCACAACTTCTATAAACGTCAATCAATATGCGCACGGCGGCCACCACAAATCGACGCGGAAATGTCTT
TTGTCCCATATATAACGCCCCTTGCTCCAATCAAACGCTCCACGTCTAACGCTGAGGCCTTACACTGCGTCCTCCGTAGAACCATTTTCGGATCCCGCCG
CTTCAAGCGCCGCGCGGAAGAGCAGCAGCCTGGCAGAAAGCAGCAGGGGCCCGGACCACGCAGGCCAGCGCGCGAGCATGGTGTTCGTGACGCTCAAGTA
CATCATCATCGGCGACTCGGAGGTGGGCAAGTCGTCGCTGCTGCTGCAGTTCACGGAGCAGCACTTCCAGCCCATCCACGACCTGACCATCGGCGTCGAG
TTCGGCGCCAAGCTGCTGGAGGTGGACGGCCGCAAGGTGAAGCTGGAGATCTGGGACACGGCCGGCCAGGAGACCTTCCTCTCCATCACGCGCAGCTACT
ACCGGGGCGCGGACGGCGCGCTGCTCGTGTACGACGTGAGCCGGCGCGAGAGCTTCGAGCACCTGGGCCGCTGGCTGCAGGAGTGCCACCAGAACTGCCA
CAACGACGAGGTGGAGATCATGGTCGTGGGCATGAAGTGCGACGTGGACGAGCGCCAGCGCGAGGTGCCCGAGGACGAGGGCCGCAGCTGGGCCGCCGCG
CACGGACTCTACTTCATCGAGGCGTCGGCCAAGACGGCGCTCAACGTCGAGCAGGTCGTCCAAGAGACAGAGGAGCGCTGCTGCTGCTTGAGGCGGAGAC
TGACTGACTGACGCTGGTGTTGCTGTTGCTGCTAGGCCTTCGCGCTCACGGCGACGACGATCCTGCGCAACTTCGACTACTCCAACCACCAGATGCGCAA
GGCCTCGGGCGCCAGTCGGGTGTCCGTAGACACCCCAGCAGAGCGGACGCAGGCCAACAAGTCCGACTGCTGCGGCAGCGGCTAGACTGGAGGATGACGA
CGAAGTTCGTTGCAGAGGCTGAATCACATGTGGCGCTCGAGATGCTCGTTGATACGGGCTTACTGCTGCAGGGCTTGTGTTGCTTATATGCGGCGATGTT
GAAGCCGAGCGTATTGCGACCCTGGTAGAGGAGCTTTTCTGGAGATCATAAATTCGAAGGGACTTCGAAACCAGTACGCGGCTCGATCGAGAAGGTCGTT
CCCTCCGTGTCTAAACGGCAAATCGAAGAATGGCTGTACGAAGGATGCCAGAAGTAACAAAGGGCCATGGCCCCAAGTGAAGACCCCGCCCAGGCACTGC
CGCCATGATGCGCATCATGAATTCAGGCCCAGAAACGATGCCTACAAAACAGTTTTTCCTACAGTTCCTTAGCGAATGCACGCACCCTAAAACCATGTTA
TTTGAAGCTCAAATAGCAGTGCGATTTCACACGAAATAGCAGTGTTAATTCTGACACCCCCTAATAGTTCTCTGGACTTTAAacaaagccgcgcttaacc
cggaacagctttggattttaacttgcggaccgatcagcatgcaacaatgggtagattcttgctgtcgtactgcttcaactttcttttataacaggaaata
ggaagtttagttgttgcttccaccaccctactaccctaatcggatctaccagtagtacagcagtgggaagttcgccttcactttttaccaatcatagtcc
gagagagcactgcttgaaactgacactgtcttacttc