Description :
From Genome Similarity Track
Location :
Scaffold_1130:9114- 11298
Transcript NameFunction/comments
Phyta_totarag1215460S ribosomal protein L8, putative
Phyta_totarag12155conserved hypothetical protein

Sequence
2184 bases(100 bases per row)
ACTATTAAATGACCACCCCGCACACAACGCGCTTGGAAGCGCTTCACGAGGTGGAGATACCAAATGCTATCGGGGCAACACCACACACACGTACAAACAC
ATCACTGTACTCCGTCGATGGTAAAAGCTCAAGTGGTGCTCCATCAACTCCGTTCAGCACACGActggtacactgtaccattTCTTTCTCCTCCAATGAT
CGCCGCGTCGGTGTTGTCACTTGGTCTCCGTATGCTTCCTTTCACCCTCCAAAATCAATCATCAGTTTTGCAAGTCCAGTGTTTGGTTGGCCATGCGCTC
TTCTGGAGCTCCCATACATTTTCGCCGTCCATTTTGACATTTCCCGGTTAAAAAAGAAGAGCAAGTATGGGTCGTGTTATCCGTGGTCAGCGTAAGGGTG
CTGGCTCCATCTTCAAGTCGCACACGCACCTGCGTAAGGGCCCCGCCGCCTTCCGCGCCCTCGACTTCGTCGAGCGCACGGGCTACATCAAGGGTGTTAT
CAAGGAGATTATCCACGACTCTGGCCGTGGTGCCCCCCTGGCCAAGGTGACGTACCGTGACCCGTAccgcttccagctcaagcaTGAGCTGCTCATCGCG
GCTGAGGGCATGTACACGGGTATGTTCATCTACTCGGGCCCCAAGGCCGCTCTGGCTGTGGGCAACACCCTGCCCCTGTCGGCCCTGCCGGAAGGTACCA
TCGTGTGCAACGTGGAGGCCAAGGTCGGCGACCGCGGCTCGTTCGCCCGTGCTTCGGGTGACTACGCTGTCATCGTGACccacgacgaggacaagggAAA
GACCAAGCTGCGTCTGCCTTCGGGCTCCAAGAAGACCGTCCCTTCGGCGTAagttgctgcttccattTTGGACGTTTTCGACAAGAAATGATTCGAGACT
CTTAGGAGTCTCGAGGCACGGCGGCGTTTCTCTCTATTATTCCCCAATGATGAGAGAGAACGTTCGCGCTGCGTTGGTGTCTTCTTGACACCGACGCGTG
TGTGTGCTATGTATCATTCTTTCCCGCCTAGTGCGGTGAGTAAGTATCTCTTGATGATTCGTGCTTCTGATTTCGGAAGTGTGATGATTTACTTTGGGGT
GCTGAGGAGGAATTGTCGTCATTGTCAAGAGGGAAGGTGACTGTGAACTATTGTGACTGACTTGTGTGCTCTCTTATGGGAACTTGATCAACAGGTGCCG
CGCTATGGTTGGTGTGgtcgctggaggaggccgtACGGACAAGCCGATCCTGAAGGCTGGCCGTGCCTTCCACAAGTACCGCGTCAAGCGTAACGAGTGG
CCGCGTGTGCGTGGTGTTGCCATGAACCCCGTGGAGCACCCCCACGGTGGTGGTAACCACCAGCACATTGGTCACCCGTCGACCGTGCGTCGCGATGCCC
CTGCGGGTAAGAAGGTCGGTCTTATTGCCGCCCGCCGCACAGGCCGTCTTCGCGGTatcaagaaggtggagaaggacaacTAAGTTGTCTAGCTCCAGCT
CATTTAGCAGCAGCCTCTGGGCTGCCCAACGGGAATGCCATAATGAAATGCTTTTCAACCAAAACACAATGTCTTTCATGTACGTCATTAAATCTTCCTT
ATCATCCGGACATGAGCCTTTCAGCGCGTCGACGCTCGGAAGcctctctctcttctcgCTCACGACTCAGGTCTTGAAGCAAAGCCTCTTTTTTGCTGAG
CTTGTGTTTGCTCTTCTCTTTGTGGTGTTTGccgcgcttcttcgatcgtttgtcctcttcatcctcctcgtGTCTACTATGACGACTATGGCGACGCCGG
TCTCCGTGTTCGGGAAACGTCGAAGAGCGGTCATACCGAGCGGAATACTTCCTACGGTCACTGCCAGCAGgcccttcttctccagcataAATATATCTGC
TTCTGTGTCTCCCTTCCTTCTCTGAacgtcgagcagcaaacaaTGAATGCTGTCCTCGCTCCTCCTTCGGACGCATGTGTTGCAATGGATcagccacctc
cagctcTCTGCAATCATCAAACACAACGTCAGCCTAACAGCCGACAGCTTCAAACTCCCCCAAAGGCATCCGTCTGCTCACctcttgcgcttgcgctcct
gCCTCACTGTCGgctccgtcttcgtcgcgtcTTCAGTCTGAGCATACCAGGGCAGCTTGCCGTGTCTTCTCAACGTATCGTCCG