Description :
From Genome Similarity Track
Location :
Scaffold_7:911058- 917295
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05308T-complex protein 1 subunit alpha
Phypa_INRA-310PPTG_05309hypothetical protein
Phypa_INRA-310PPTG_05310Rab11 family GTPase
Phypa_INRA-310PPTG_05311hypothetical protein
Phypa_INRA-310PPTG_05312hypothetical protein

Sequence
6237 bases(100 bases per row)
CCGTCAGCTCCATCAACGTGCTGAAGGCACACGGTAAGAGTGCGCTCGAGACGCAGCTGGTGGACGGATTTGCTCTCAACTGCACCAAGGCGTCGCAGCA
GATGCCCACGTACATCAAGAATGCCAAGATTGCGCTCTTGGATTTTGACTTGCAGCGTCACCGTATGCAGATGGGTGTGCAAGTGGTAGTAAACGACCCC
AACGAGCTGGAGCTGATCCGTCAGCGCGAGATTGACATCACCAAGGAGAAGATCCAGAAGATGATCGACGCTGGAGCTAACGTGATCCTGACGACCAAGG
GCATTGATGACTTGTGTCTCAAGTACTTTGTGGAATCTGGCTGCATGGGTGTGCGTCGCTGCAAAAAGGAGGATCTGCAGCGCATTGCCAAGGCAACCGG
TGGACAGGTTGTGCTCACACTCGCCGACATGGAGGGCGAGGAGACGTTCGATCCTTCGACCCTTGGCGAGGCACAGGAAGTTAGCGAGGAGCGTGTCGGT
GACGGCGAGCTTATCTACATTAAGGGCTGCAAGACGCGTCAGGCTACGACCGTGGTGCTTCGTGGTGCCAACGAGAACATGCTGGACGAGATGGATCGCT
CGATGCACGATGCCTTTATGGTTGTCAAGCGTATGCTTGAGAGCAACCAGCTTGTTGCTGGTGGAGGTGCAGTGGAGGCGGCTTTGTCTATCTACCTCGA
GAACTTCGCTACGACGCTGGGCTCCCGGGAGCAGCTGGCTATTGCTGAGTTCGCTGACTCGCTGTTGGTCATCCCGAAGACTCTGGCGGTTAACGCCGCC
AAGGACGCCTCGGAACTGGTGGCACGTCTGCGTGCGCACCACAACACATCGCAGAGTGACGCTGCACAACGCGAGCTGCGTTTCTCGGGTCTGGATCTGC
TGGAGGGCACTGTGCGCAACAACCTGGAGGCTGGTGTCGTGGAGCCTGCTATCAGCAAGATCAAGAGCCTGCGTTTTGCCACTGAAGCTGCCATTACCAT
TCTGCGGATTGACGATCTGATCAAGCTCAACCCTAAGGAAGAGCCCCAGCAGTAGGCTTCCATCTTCAGGGTAGATGGCAATAGCGTTTATAATAACACT
CCTTTCAGCCCATGTACAGCATTCTATTCACCCTCTTCAGCTTGTTCCGCAGCCTCCGCCTCGCGTCGATGCTTTAATTCCACTGCAGCCAAACGATCTT
CGTCAGTAAGCGGCTCACCGTCAAGGTGTGTCAGCGTCGGTGCCAACAAGATGATCGCTGAACGGTAATCTTCCGCTTGAGTCACTGGATTCCCTATCAA
GTTCAACGTCGTCAGCTTGGTTAATTGATCGAGTTGCTGCACGGCCTCGAGTGATTCGATCTGCAGCAATATCACAAGCAAGCAGATTGGTTTGAATCTC
ATTCATCAGTAAGAAAAGATAAGTAAGTAAATAGGCAACTTACGTAGTTCTGCTGGACAGACAGCGAGGTCAGCTCTGACAAGCTTTCAATGCCGCTCAA
CGACGTGATTTTGTTATCATCCTGAAAGTCGAATCAGCGATTATTCGGCAATTTCAAGCAGCATGTTGATGATATTGACTTACCAGGCAAAGTGTTTCGA
GTTTGGGCGCTGTATCACTCGCAAGGCTGCTAATATCTTCCAGGTTGTTGCGAGATGCTTCTAGAGTGGTGAGGGACGGCAAACTCTGAAGCCCAATGAG
GCTTGTAAACGCATTACCTGCAGCACCAACACCAAATTGTAAGTGTATGAAGCACCACAGAGCGTTATAACAGCACGATACCGTTGATCTTTAGCACCGT
GAGGGAGCCCGATGTAAGACCCTGCAGTTCTGCGATCTGGTTTTCAGAGACATCGAGCGACTACAAGCAACCGTGTAAGTTGAGCATGCCACCTGAAAAG
CACACTGACGCCATACCTGTAGATATGGCTGAGGAAGTGTTGGCGGTGCAGTGAGGGCGTTGCTTGACAGATCGACAACCACGAGATACGGAAGCTCCGA
CAGCGGCGAGGCATCAGCGATTTGGTTCTTGGATACGTTCACGTAGAGCAAGTGCGAATAGCTCTTAATCGGCTCCAGACTCACCAAGTCTTTCTCCTAT
TGCACCATACATACATTTTCCATATGAGCTTTTGACTGTGCGAGAAACAAGATAATGCGAACGTACAATGACATCGAGAGCTGTGAACGCGTAGCCAGAG
TCGTCCACGACACGATCCACGCGGGACAATCCCTCCATGTAGACCTGGATGTTAATCTCTTCAGCCATTCTCGCCTCACGAATTTATCCTTCTTCTTAAA
TTCGCTGTTGGAGATAAGCGTTGAGCATTAGGAGGTCGCTGGTGGCAAAACCGTCTGCGACCAAAAGACGCCGAGCTCCTTAGGTATAGCACCCCTGTTG
GCTGACCAGATATGTCTTCTCCATCCAGTCAACGACGTCACTCGTCTCTGCTGCCTGCTGAAGCCTTTGCAACTGATGACGACTCGGACTGTACGGTTAC
CTAGCTTCTCGTATGATTCACGTTATTTCTTCTTCTTGTCTGACCGTGCTCTTCTTCCCGAATCTTTGTGTAGATCTGCCATGGCAGATTGCCTTCCGAG
TCAAGTTCCCTAGTGAGAAGCTCGGATTACGCTTTCACCCGGCTCAATTCCCAGACACAGGCAATGGCATCTACACAATACGTTTACTGGAGCTCACCAG
GGTAAGTGAACTATTCATCGGAAAAAGCTGCGAGCTATGAAATCGCTAATGAGCGTTCGGCCCAGGGAGCTGACGGCAGTGGGCCGGCTCAACAGTACAA
TAAGCACTTGCAGCCCGGACAGGAACACTTGACGCTGCGGCCTGGGCTGTATCTGACCCACATCAATGACAACCATCTGGTTGAAGTGCCCTGCGAAGAG
ATCATTCAGAGGTGAGTTGCTGTAGACGAACTTGGACCAAACGAAGCGTCTAACTGCTTGTATTCATAGCCTGCAGACAACTCCACGGCCTATTACACTA
CGCTTTGTTGATGTTGAAGCGGGTGTGGTGACTCGCCACGAATTACGAGAATCATTGCGCTTAGACGGCGATGAACTGTCTGCTGCTATCGCACAACTTC
CAGGTTCCTCGAATACCTCTCCGCGACGACATCCTCCATCGCCAACCAAGATTATAAGTGAACACATATACAAGATTATTCTACTGGGCACAGCAGGTGT
GGGCAAGAGCAGTCTCTTGGCTGTGGCAACAAACGGCGACGACGCGTACATGGTACGGTGATCTTATCAAATAGATTTACGCTTGGGTACTCACGCTGTT
GTTTCCTCAGGATCGACGTCCGCCAACACTAGAGGCGGAGTTCGGCACTATTGAGTTCCCAGACCCAAGCGACTACAGCGGCACGAAATTTACCAAGGCC
CGGATCTGGGATACTGCCGGGCAGGAGCGCTTCCGAGCCATCACTCGGTCGCACTACCGTCGTGCAGATGGTGCTCTGCTTGTGTACGACGTCAGTGACG
CGCAGAGTTTCGAGCGTCTCAGCGAGTGGCTCCATACGCTACGCGAGACTGCAGGTGATTCGCTCACCGCAGCGATGGTGCTCGAGAACAAAGTGGACAA
ACTGCCTAAAGACTCGAGACCAGCCAAATACGCACAGCCAGAGAAGGTTAAAGCTTTTTGTGAGGCTCAAAACCTCCTGTTCGCGCGTACAACTGCGAAG
CTTAACGCTCGTGCAAGGGAATGGGACGGTGCACTCAAAGTGTTCGACGCTGTGCGGCAGCTAGTGCTCCACATCCACGAGACGCGCACGCGCCCGGTGT
CCCCTTCCAAGCAGACTGAAATCGCCAAGACCACCGACAGGACCGAGTCAATCAAGCTGACCGCGGCAATAACCACTCAGCCCAAGAAATCCAAGCTGCT
GGATGACTGTGGAGGCTGCAATCAATAGGCAAAGTACTACCTAGGGATTGCTAGATGTTTGGTCGCACATACTTCTTACACCCAATGCTAAGAGATAAAA
ACCCTGAAGGACCAAGACTTGTTCACTGTAGGACGGTCGTATCGTGCGCAACGAACCAGTGGTTCGACTGCCTCTCGGGGGCTCAAGGAGGCAAAGGCAC
TTCTAGCGGAGGGCTTATGAGCTCTCCTCCGTCCAGCTAAAGACACACAAACACGTAGGATACCCATGCCACGGCTACGCCAAGTTAAACTGCGAGTGAA
TCCGTGGTCGTGCAAACTACAAGAGCGCACTAAAAAGGTAGACTATGCTGGTTCTTTCAATTACAATTTCCAGGATTAATCTTCTATCGGAGATGTTATG
TGGACCACAATTCGGCGCTTACGCTTGTGTCCAGGTTACGTCCCGGATGGTACCCCATGACGCCACGACTGATCACATAGTGAGCGCAAGACAAGCCACT
CGCCAATTTCGCTTACGCCGCTTCTCGAGCAGAGCACCATGAGTCGCTCGCAGGCATCGCTGGCGCTGCTGCTGGCGCTACTAACGTCCATCGCGTCCGC
GCTCGTGATAGAGAGGTACATACTTTACTGCTTGGCGTTGTAGCAAAATGTTTTATTACGTGGGACACTAATCAGGTTACATTATTCTGCATTTCCATCC
AGCCCGGACTGCCGTCTAATGACGCATGTGTACGTAAATTACAGTCGAAGATGCGGTTGCATGTATAGTAACATGGTCACTCTCTATCCATCCGCAGCTC
TGGCGAGTTCACCAACCTCACGATGCTGGAGTCCGGCGGATTGAAGAACTTGGAGATCGTACCAGGTAAGCAAGCAAGCTGCTGCAGTTTATTGTTGCTA
TGATATAATTCCTAACGTATTACGACCAACGTATTGTAGTGGTCCCATTCACGGCATGCGAACCGCTGCGTGGCCAGGATCTGACGGGCAAAGTGGCGCT
CGTGTTGCGTGGCGACTGCAACTTTGTACAAAAAGTGTGGCACGCCCAACGCGCCCACGCAGCTGCCGTCGTAGTGATGGACAACGAGCTGCGGCACGAG
TACGACCGATGATCTCACTCTCCTATATGTATTGACCTAATAGCCTGTGTATTGCTGTAGACCTCCGTACCATATTATCATGATGAAGGATGAGATGGCG
AGCAGTATCCGCATCCCGTCGGTCTTCATCTCGTATGTGTCTGGTGAGTGGCTACTAGACGCCATGAGTCGAGCTGTGCCCTGGAACCCGCTACGGATGA
CGCTCGATACTAATGGAGAACGTGAGTATGTTAACAATACATGCATATTATGGAGGACTGATGATGTATTTGTATGCAGTACCACAAGCGTCAACGTCGA
ATCGCTTGCTGAAGCGTGTGATCGCCTACATTTTCCTCATTTCTATCGTCTGCGCGTTCTCCAGTGGGCTGAGTTTGCTGTCGTCGGCGATTTTCCAGTG
GGTTGGCAAGACCCGGCGAACGCGTGCAGCCAAGCAGCTGCCGATCGCCAAATACGAGCGAAACATGCAACGCACACTGCTGGAACACTTGCTGGAAGAG
CAATTCGTGCTTGATCGCATCCCACTAGCCGAGATTGAGAACGTTTCCAAGACAAGCGACCGACATACGGAAACTGAACCAGATTTCAGCACTGAGATGA
CTGCAAGTTCACAAGAGGGAGATACAGTCCCTGATGATATTTATCTCGAGAAGGAAGAACAGATGCAGCAAAAGGAAGAGCCACAAACGGACGGAATCAC
TTATCGGAGCTCGACTGACTCAGAAGCGGAGACTTGTCCAATATGTCTGGACGACTTTGAAGACGGAGCGGATGTTAAGGTTCTCCCGTGCCAGCATTTC
TTCCACGTCGACTGCATCAACCCGTGGCTCGAAGGTCGAAGTGGACGCTGTCCACTCTGCAAGCAAGACGCTATTGCTACCAGTACGTTCCTAACCTCCG
TTGTTCCATCTGATTGCGACTAACGAAATATGTGTTAATCTTTGTTTCTATAGTCGCTGGCGCATCTAAGAAGATCTTCGGCTTTCCGTTGCCTCGTGTT
GACCAGATTCTTCAGCAGGAACATGTACGTTGGTGGTGATTTAACGGACTTTTATAGTGATAGATTTCTGACATGTCTTGAGTGTATTTGTAGTGGGTCC
ACACGTTCTTCCTCATGCTGCCTGCAAGTTTTATCAGCTGCTTAATTGTCAACGCCGCCGCCTCCATCATCGGCACCATGTGGCCGTAAGAGGTTGCCCT
GCCAACCGCTTCCCACATCTCTTCTGTATTCGCCGAG