Description :
From Genome Similarity Track
Location :
scaffold_5:91087- 92414
Transcript NameFunction/comments
g8113.t1 conserved hypothetical protein

Sequence
1327 bases(100 bases per row)
AGGCGTGTTTACGTGCACTTTGCGTAAAAAATGGATTGACCAATCACAGCGCGCTACATACATTTTTCTGCGTGTATTTGTTCATTGCTTACGTCAAACG
ACCTTCAGAAGTCGCCACCACTTCAGAAGCCAATTGGCAGCAATGGCGTCTGCGATCATCGCGTTGCCGACGTCCTCCCCGCCGAAGAAGTTGCGCGTCC
TGTGTCTTCACGGCTTCCGCACGAACCGTCAAGTGATGGAGACCCAGACACGTGGACTGCGGGACGCTCTAGGTCCCAACGCCGAGTTCGTCTTCCTCGA
TGGTCCGTTCGAATCCCGCGGGCCGACGGACGAAGTCATCGAGCGCTTGTTCGGGGACACGGCGCCGTTCTACGAGTGGTGGGCAGCGCGTTACCTGGAG
AAGGAGGAGCGGGAGGATATTGAGGCCGAGGAGGGCGTCCCAAGGGGCACTACCAAACGCTGGTGCCTTGAGTTCAGCGACATGGACCAAGCCATCGAGT
ACATGGACGAGAAGCTTACGCAGCTGGGCGAGTTCGACTTGGCCGTGGGCTTTTCGCAGGGCTCCATCATGCTCACGATTTTGTCCATGTGGTATCTCAA
GAAGACCAACAGGCGCTGGTGGAAGCTCGTACTCTGCGTCTGCGGCGTGTATCCGCGCGGCATCAACGTCCGGGAGCTGTTCGAGACGCACGACGGACAG
CCGATTCAGGTGCCGCTCCCGTCGATCCACGTCGTGGGGAAGAAGGACAGTTTGTACCAAGAGTCGCTAGTTCTCAAGGACATGTACACAGCGCACGCCA
AGGGCAGCCCCTTGGCGAGACTGCTGCTGGAGCACGACGGAGGACACAAATTTCCATCTCCCGAGCGACACCAGGATTTTTATGCGGACTTGGCCAGCAC
AATCTGGCAGTTCTTTGAGGATACACGCCAGAGCTCGGTGGCACGACTCTGAGGCGTACTGTTAGTGTGTATAGACAGCAACCACCAGAATATAGTCACT
GCTTGACGTGTTTAACAATCCGAAGTTGCTCAATTTGAGCCTCAAACACCAGAGTTGAGTCGCTCGTGACGTCAAATCCATGGCCAATTTGTGTACGCCA
GCCTGCTTGAAGTTGGATCTGCTCACTCGACATTTTCCAGCATTTCCAGCACTTCCCATGGTGATCGTCGCCGAGAAGCTGCCTCACCCTACGGCGCGTA
ACCCGCGTCCATTCGACTCGTCTAAGAAGATCCGCGTGCTGTGTTTGCATGGGTTCCGCACGAACAGGCAGGTGATGCTGGACCAGACGCGCGGGATTCG
AGCTGCTCTGGGCGACTCGGCAGAGTT