Description :
From Genome Similarity Track
Location :
contig_5:91071- 92399
Transcript NameFunction/comments
g1506.t1hypothetical protein

Sequence
1328 bases(100 bases per row)
AGGCGTGTTTACGTGCACTTTGCGTAAAAAATGGATTGACCAATCACAGCGCGCTACATACATTTTTCTGCGTGTATTTGTTCATTGCTTACGTCAAACG
ACCTTCAGAAGTCGCCACCACTTCAGAAGCCAATTGGCAGCAATGGCGTCTGCGATCATCGCGTTGCCGACGTCCTCCCCGCCGAAGAAGTTGCGCGTCC
TGTGTCTTCACGGCTTCCGCACGAACCGTCAAGTGATGGAGACCCAGACACGTGGACTGCGGGACGCTCTGGGTCCCAACGCCGAGTTCGTCTTCCTCGA
TGGTCCGTTCGAATCCCGCGGGCCGACGGACGAAGTCATCGAGCGCTTGTTCGGGGACACGGCGCCGTTCTACGAGTGGTGGGCAGCGCGTTACCTGGAG
AAGGAGGAGCGGGAGGATATTGAGGCCGAGGAGGGCGTCCCAAGGGGCACTACCAAACGCTGGTGCCTTGAGTTCAGCGACATGGACCAAGCCATCGAGT
ACATGGACGAGAAGCTCACGCAGCTGGGCGAGTTCGACTTGGCCGTGGGCTTTTCGCAGGGCTCCATCATGCTCACGATTTTGTCCATGTGGTATCTCAA
GAAGACCAACAGGCGCTGGTGGAAGCTCGTACTCTGCGTCTGCGGCGTGTATCCGCGCGGCATCAACGTCCGGGAGCTGTTCGAGACGCACGACGGACAG
CCGATTCAGGTGCCGCTCCCGTCGATCCACGTCGTGGGGAAGAAGGACAGTTTGTACCAAGAGTCGCTAGTTCTCAAGGACATGTACACAGCGCACGCCA
AGGCAGCCCCTTGGCGAGACTGCTGCTGGAGCACGACGGAGGACACAAATTTCCATCTCCCGAGCGACACCAGGATTTTTATGCGGACTTGGCCAGCACA
ATCTGGCAGTTCTTTGAGGATACACGCCAGAGCTCGGTGGCACGACTCTGAGGCGTACTGTTAGTGTGGATATAGACAGCAACCACCAGAATATAGTCAC
TGCTTGACGTGTTTAACAATCCGAAGTTGCTCAATTTGAGCCTCAAACACCAGAGTTGAGTCGCTCGTGACGTCAAATCCATGGCCAATTTGTGTACGCC
AGCCTGCTTGAAGTTGGATCTGCTCACTCGACATTTTCCAGCATTTCCAGCACTTCCCATGGTGATCGTCGCCGAGAAGCTGCCTCACCCTACGGCGCGT
AACCCGCGTCCATTCGACTCGTCTAAGAAGATCCGCGTGCTGTGTTTGCATGGGTTCCGCACGAACAGGCAGGTGATGCTGGACCAGACGCGCGGGATTC
GAGCTGCTCTGGGCGACTCGGCAGAGTT