Description :
From Genome Similarity Track
Location :
contig_5:91064- 92390
Transcript NameFunction/comments
g1626.t1hypothetical protein

Sequence
1326 bases(100 bases per row)
AGGCGTGTTTACGTGCACTTTGCGTAAAAAATGGATTGACCAATCACAGCGCACTACATACATTTTTCTGCGTGTATTTGTTCATTGCTTACGTCAAACG
ACCTTCAGAAGTCGCCACCACTTCAGAAGCCAATTGGCAGCAATGGCGTCTGCGATCATCGCGTTGCCGACGTCCTCCCCGCCGAAGAAGTTGCGCGTCC
TGTGTCTTCACGGCTTCCGCACGAACCGTCAAGTGATGGAGACCCAGACACGTGGACTGCGGGACGCTCTGGGTCCCAACGCCGAGTTCGTCTTCCTCGA
TGGTCCGTTCGAATCCCGCGGGCCGACGGACGAAGTCATCGAGCGCTTGTTCGGGGACACGGCGCCGTTCTACGAGTGGTGGGCAGCGCGTTACCTGGAG
AAGGAGGAGCGGGAGGATATTGAGGCCGAGGAGGGCGTCCCAAGGGGCACTACCAAACGCTGGTGCCTTGAGTTCAGCGACATGGACCAAGCCATCGAGT
ACATGGACGAGAAGCTTACGCAGCTGGGCGAGTTCGACTTGGCCGTGGGCTTTTCGCAGGGCTCCATCATGCTCACGATTTTGTCCATGTGGTATCTCAA
GAAGACCAACAGGCGCTGGTGGAAGCTCGTACTCTGCGTCTGCGGCGTGTATCCGCGCGGCATCAACGTCCGGGAGCTGTTCGAGACGCACGACGGACAG
CCGATTCAGGTGCCGCTCCCGTCGATCCACGTCGTGGGGAAGAAGGACAGTTTGTACCAAGAGTCGCTAGTTCTCAAGGACATGTACACAGCGCACGCCA
AGGCAGCCCCTTGGCGAGACTGCTGCTGGAGCACGACGGAGGACACAAATTTCCATCTCCCGAGCGACACCAGGATTTTTATGCGGACTTGGCCAGCACA
ATCTGGCAGTTCTTTGAGGATACACGCCAGAGCTCGGTGGCACGACTCTGAGGCGTACTGTTAGTGTGGATAGACAGCAACCACCAGAATATAGTCACTG
CTTGACGTGTTTAACAATCCGAAGTTGCTCAATTTGAGCCTCAAACACCAGAGTTGAGTCGCTCGTGACGTCAAATCCATGGCCAATTTGTGTACGCCAG
CCTGCTTGAAGTTGGATCTGCTCACTCGACATTTTCCAGCATTTCCAGCACTTCCCATGGTGATCGTCGCCGAGAAGCTGCCTCACCCTACGGCGCGTAA
CCCGCGTCCATTCGACTCGTCTAAGAAGATCCGCGTGCTGTGTTTGCATGGGTTCCGCACGAACAGGCAGGTGATGCTGGACCAGACGCGCGGGATTCGA
GCTGCTCTGGGCGACTCGGCAGAGTT