Description :
From Genome Similarity Track
Location :
Scaffold_359:9105- 11267
Transcript NameFunction/comments
g13861.t1XP_009514637.1 hypothetical protein PHYSODRAFT_462863, partial [Phytophthora sojae

Sequence
2162 bases(100 bases per row)
TGTAACGGGGTACACCGACGTGTACCCATGTTACATAAAGAGTGACGGGATGTCTCTCTTTTGTGCCCATGGTACGTGGTACCAGTTGGCGGTGAGCCAA
CCATTAGGCACTTGTTTAGCTTTTACTATAGTTGACTTAGAGTTTGTAAGGATCAAGCTTGACTCACCTATAAATATATTCAGTCTTTAAACCTACCGTC
TAAGTCGTAGTCGGTTCCCTTAGACCGGGAACCGTGAACTTGTTGTTCACCGAGAGCTTACGCTCTCTAGCACTTCCTCAGTGCAAGGTGCTGTGTGCCC
CGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAAGCCTGAACCACTATGGAACG
AAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGAAAGATGGGAGGCAACTTTGGGAGGGATGTCCTCCGAGGCTTGGCGTCGGTGACG
CCAGCCGAGCAAGTCGAACGCGTGAACGCGTTTGACACGTATGAGCGTGAGCTCATTGCTCACATGCAGGGAAACCTGCAGGTCTCTGTGGCCGAGCCGA
AGCCGGTCCAGCCGAAGCCTTTGCGGCTGACTGTACCTGCGTTCGAAGGGAAGGAAGGTGAAAACCTTCACTTCTGGATCCGAGAAGTTGAGATCGCCAT
GAGGGCGGGTCTCATCTCGGATCAGGGACTTCGCGTTGCGTTCGCGTTGTCCAACCTAAGCGGTCGTGCCAAGAATTGGGCGTACACGCTGGAGACGACG
TCTCCTGGATGTTTTGCATCCTGGGAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGCGTTCCGCCAGTGCTCACGCTTCCTCG
CCTGTAAGCAAGGGAAGCGCGAGCTGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCGTTGGTGGGGAACCCCCTGCCCGAAGACGTCAAGAC
GACGGTCTTCATGGACGGCCTGAAGGTCGGTCCCGCACGCACGCAGTTATTCCGCGTGCATGCATCAACTATGGAGGAGGCGATTAAGATCGCCCTCCAG
GAGGAGTACAGCCATAAGCAGGCTGGTACTCCGGTTGTTGTGCAACTTGTCGTTGCGAACAACGAGCCAGAGCCTATGGACTTGAGCTCTGCTGAGCTTG
GCTCAGTCCGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGTGTGTGTCCTTCGACTGGGGTGGGGAAGAACCCATCCCTCAAACCCCGAGGGCC
TAACGGTCGCTGGCGCAAGCCGCGACCAGGTGGCCGAGGGAACTCCGGCCACCAGTAATGGCGGGTTCCCCAGAGGGGGGAGAGTTGAGTCTCCGTGACG
GGTGTGCGGGTAGTGCACACCATGGAGGCTTAGCCTACGAGAGACATTATGTCTCGAATCGGTGATGGCAACGCTGGGTTGCCGTTAGTACACGTGAGTG
TACGGGGATGTTAATATCCCTAGGAACGTTTAGTTCCAGGGGCGTCGAATGCTTTCGTACGCCGCCGGAGCGATTGCCAACTCTCTGTGAGAGAGCATCG
GCAATGGTCTGCATAGACCTTGCTGTCAGGTTCACATACCTGAACAGCTGCGACCCGTACGTGGTCGTGGACACGTACGGCGTCCGCTTGGGTGCGCCGT
GCCATGGACGCACGCACCCTGAAGCAATTGGTGTCAGAAAGCCATCTAGGCTAACCGGTACCCAGCTTCTGGCAGAGCATTGGTGAGTCATGACCCCACC
TCTGCCAGAACACACGGTATCCGAAAGGATTACCAGGACGTAATGGCGTCCGCCGACGTACGGAAGTCGTTGGAGTAGTTGCAGCTGCAACAGGTGTTGA
GACACCGTCCACTGCGGACAATGGACCGCCACAGGCAATGCCGGTGGACAGGACTAATAGTCCAGCGAGGGGAGCTGCAACGCCAGCAGCACCCACCGCT
CCTGATCGTGGCGCCATACAGGCCTCGACTGTATCAGCGCCAGGCGATGTCAGCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGTCGAGACCGT
GGCCAGGGCTGAGGTTGCCGAGAGCACCTCCTGTGTGGGTAACAATGTTCCACACGGAGTCG