Description :
From Genome Similarity Track
Location :
Scaffold_80:91034- 92415
Transcript NameFunction/comments
Physo_139941gag protein

Sequence
1381 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGTTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATCCTCTGTGGTCTCATCAAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCA
TCTTTGGGACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGC
CCACGTTCAAGGGCTGCAGGACACTGCGGCCGCACCGAAGCCGGTGCAACCGAAACCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAA
AACCTTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCAACTCCGTGTCGCCTTTGCGCTTTCCAACCCTAGTG
GTCGCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCC
GGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCAGTGCC
TCTTTGGTGGGGAACCCCCTGCCTGGACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAG
CAAACACTATGGAGGAGGCGATTCAGATCGCCCACCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTC
TGGCGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGACCGAGCAGAGCGACATTCGCTGCTACGGC
TGTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGC
CGCGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGC
CATGGGGACTTAGCCCCTGAGAGTCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGT